WormMine

WS296

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00009242 Gene Name  sre-6
Sequence Name  ? F28H7.9 Organism  Caenorhabditis elegans
Automated Description  Predicted to be involved in sensory perception of chemical stimulus. Predicted to be located in membrane. Biotype  SO:0001217
Genetic Position  V :2.75642 ±0.000646 Length (nt)  ? 2221
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00009242

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:F28H7.9.1 F28H7.9.1 1189   V: 10760575-10762795
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:F28H7.9 F28H7.9 1101   V: 10760658-10760867

2 RNAi Result

WormBase ID
WBRNAi00045886
WBRNAi00008717

26 Allele

Public Name
gk963301
gk964451
gk964452
gk963495
gk963496
gk964351
gk964304
WBVar01865168
gk246112
gk246116
gk246115
gk246114
gk246113
gk246117
gk948889
tm11023
WBVar01743206
WBVar01461570
gk620719
gk414290
gk850730
tm12016
gk841125
gk556792
gk574070
gk913086

1 Chromosome

WormBase ID Organism Length (nt)
V Caenorhabditis elegans 20924180  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00009242 10760575 10762795 -1

3 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  

0 Downstream Intergenic Region

68 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells. DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction. WBPaper00060811:L1_vs_adult_upregulated_neural
  Transcripts of coding genes that showed significantly decreased expression in muscle. DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. WBPaper00062325:muscle_depleted_coding-RNA
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:OsmoticStress_regulated_Food
  Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology. DESEQ2, fold change > 2 and FDR < 0.01. WBPaper00062103:neuron_enriched
  Transcripts that showed significantly increased expression in csr-1a(tor159) comparing to in N2 at 25C. DESeq2, fold change > 2, p-value < 0.05. WBPaper00061753:csr-1(tor159)_upregulated_25C
Bacteria infection: Enterococcus faecalis Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50. For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
  Genes with expression level regulated by genotype (N2 vs CB4856) at Late reproduction stage (96 hours at 24 centigrade). Authors permuted transcript values and used a genome-wide threshold of log10 P-value = 2, which resembles a false discovery rate (FDR) of 0.0118. WBPaper00040858:eQTL_regulated_reproductive
  Transcripts that showed significantly altered expression at URX, AQR, and PQR neurons in camt-1(ok515) animals comparing to in wild type AX1888-1 strain. RNA-seq data were mapped using PRAGUI - a Python 3-based pipeline for RNA-seq data analysis. WBPaper00061902:camt-1(ok515)_regulated_URX-AQR-PQR
  Transcripts that showed significantly decreased expression in hpl-2(tm1489) comparing to in N2 animals. DESeq2, adjusted p-value < 0.05, log2 fold change > 2 or < -2. WBPaper00054493:hpl-2(tm1489)_downregulated
  Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals. DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2. WBPaper00062159:hda-2(ok1479)_upregulated
  Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage. DESeq2, fold change > 2, FDR < 0.05. WBPaper00066594:ilc-17.1(syb5296)_upregulated
  Up-regulated genes (fold change > 1.5) in two CoQ-deficient clk-1 mutant strains (e2519, qm30) compared to wild types N2. Fold-changes of intensities were calculated from the arithmetic mean of gene expression values between experimental and corresponding control group. Fold change >= 1.5 was used as cut-off. WBPaper00045774:clk-1_upregulated
  Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014. N.A. WBPaper00026929:sir-2.1_overexpression_regulated
  Transcripts that showed significantly increased expression in daf-2(e1370) neurons comparing to in N2 neurons at day 8adult stage. DESeq2, FDR < 0.05, fold change > 2. WBPaper00066978:daf-2(e1370)_upregulated_neuron
  Transcripts that showed significantly increased expression in daf-16(mu86);daf-2(e1370) neurons comparing to in daf-2(e1370) neurons at day 8adult stage. DESeq2, FDR < 0.05, fold change > 2. WBPaper00066978:daf-16(mu86)_upregulated_neuron
  Transcripts that showed significantly decreased expression in whole animal day 1 N2 adults comparing to in whole animal day 8 N2 adults. DESeq2, FDR < 0.05, fold change > 2. WBPaper00066978:Day1Adult_vs_Day8Adult_downregulated_neuron
24 hours of AgNPs exposure. Genes downregulated more than 2 fold after 24 hours of AgNPs exposure. Statistical differences between the control and exposed worms were determined by a parametric t test, and a Pearson correlation test was performed for correlation analysis, using the Statistical Package for the Social Sciences (SPSS, Chicago, IL). WBPaper00034661:AgNPs_downregulated
  Genes that showed significantly decreased expression in daf-19(m86);daf-12(sa204) comparing to in daf-12(sa204), at L1 larva stage. BRB Array Tools were used to identify genes with statistically significant variation in expression. The probability threshold was set at a maximum of 0.05 (p-value <= 0.05) for genes to be considered statistically differentially expressed in wild-type and mutant populations. Genes with a signal variation of 1.5-fold or greater were selected for subsequent experiments. To reduce false discoveries, a class comparison test was conducted using a multivariate per mutation test with a confidence level of 97% (L1 analysis) and 90% (adults). WBPaper00053550:daf-19(m86)_downregulated_L1
Fungi infection: Harposporium sp. Genes with decreased expression after 24 hours of infection by Harposporium Fold changes shown are pathogen vs OP50. For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. WBPaper00038438:Harposporium_24hr_downregulated_RNAseq
moderate static magnetic field Transcripts that showed significantly decreased expression after exposure to moderate static magnetic field. N.A. WBPaper00064509:static-magnetic-field_downregulated
Bacteria infection: Photorhabdus luminescens Genes with increased expression after 24 hours of infection by P.lumniescens Fold changes shown are pathogen vs OP50. For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. WBPaper00038438:P.lumniescens_24hr_upregulated_RNAseq
  siRNAs that showed significantly lower expression (log2fold > 2, padj < 0.01) in hermaphrodite gonad (somatic gonad plus germine) than in male gonad (somatic gonad plus germine). DESeq2 v1.13.8, fold change > 2, FDR < 0.01. WBPaper00056161:male_enriched_siRNA
  Transcripts that showed significantly increased expression in uthIs235 [sur-5p-hsf-1-unc-54 3'UTR + myo-2p-tdTomato-unc-54 3' UTR] comparing to in N2. DESeq2 FDR < 0.05, fold change > 2. WBPaper00067474:HSF-1(OverExpress)_upregulated
Feeding for 4 hours after L1 arrest. Transcripts that showed significantly decreased expression after 4 hours of feeding of starvation-induced arrested L1 N2 animals, comparing to animals continue to starve. DESeq2, FDR < 0.05, fold change > 2. WBPaper00067518:food_downregulated_N2
Feeding for 4 hours after L1 arrest. Transcripts that showed significantly decreased expression after 4 hours of feeding of starvation-induced arrested L1 raga-1(ok386)animals, comparing to animals continue to starve. DESeq2, FDR < 0.05, fold change > 2. WBPaper00067518:food_downregulated_raga-1(ok386)
Feeding for 4 hours after L1 arrest. Transcripts that showed significantly decreased expression after 4 hours of feeding of starvation-induced arrested L1 rsks-1(ok1255) animals, comparing to animals continue to starve. DESeq2, FDR < 0.05, fold change > 2. WBPaper00067518:food_downregulated_rsks-1(ok1255)
  Genes that showed significantly decreased expression in after 5 hours of 30ug/ml tunicamycin(TM) treatment comparing to control animals. N.A. WBPaper00045390:tunicamycin_downregulated
Starvation 2-4 hours at L1 larva stage since hatching. Genes that showed significantly changed expression by starvation for 2-4 hours after hatch, by comparing N2 starved and N2 fed animals at L1 larva. Normalized log2 GCRMA values were used to assess significance of expression changes with the LIMMA/GCRMA empirical Bayes test. A threshold for significance at a q-value (FDR) of less than 0.05 was used to determine if a gene is differentially expressed. WBPaper00053236:Starvation_regulated_N2
Bacteria infection: Enterococcus faecalis Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50. For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. WBPaper00038438:E.faecalis_24hr_upregulated_RNAseq

6 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr2034535 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC10849 [F28H7.9::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAGAGCACTTCCCTGAAGGAG] 3' and primer B 5' [CACTGGAAGAACTGATTACCTGAA] 3'. Expr5913 Adult Expression: intestine; Nervous System; nerve ring; tail neurons; Larval Expression: intestine; Nervous System; nerve ring; tail neurons;  
    Expr1019210 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr2016310 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
Original chronogram file: chronogram.279.xml [F28H7.9:gfp] transcriptional fusion. Chronogram1398    
    Expr1149790 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  

4 GO Annotation

Annotation Extension Qualifier
  located_in
  located_in
  located_in
  involved_in

0 Homologues

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00009242 10760575 10762795 -1

4 Ontology Annotations

Annotation Extension Qualifier
  located_in
  located_in
  located_in
  involved_in

0 Regulates Expr Cluster

1 Sequence

Length
2221

1 Sequence Ontology Term

Identifier Name Description
gene  

1 Strains

WormBase ID
WBStrain00001540

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrV_10762796..10764365   1570 V: 10762796-10764365 Caenorhabditis elegans