WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00010410 Gene Name  nhr-267
Sequence Name  ? H22D14.1 Organism  Caenorhabditis elegans
Automated Description  Predicted to enable DNA-binding transcription factor activity; sequence-specific DNA binding activity; and zinc ion binding activity. Predicted to be involved in regulation of DNA-templated transcription. Predicted to be located in nucleus. Biotype  SO:0001217
Genetic Position  IV :4.13107 ±0.004782 Length (nt)  ? 1513
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00010410

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:H22D14.1.1 H22D14.1.1 1035   IV: 9284893-9286405
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:H22D14.1 H22D14.1 1035   IV: 9284893-9284979

10 RNAi Result

WormBase ID
WBRNAi00044566
WBRNAi00013256
WBRNAi00016294
WBRNAi00033738
WBRNAi00068654
WBRNAi00068655
WBRNAi00068656
WBRNAi00068657
WBRNAi00069035
WBRNAi00069034

16 Allele

Public Name
gk964278
gk964500
gk962765
gk962666
gk602
gk667
gk963936
WBVar02124205
WBVar02123925
tm1820
ttTi44741
WBVar01896598
gk912344
gk451703
gk414225
gk564130

1 Chromosome

WormBase ID Organism Length (nt)
IV Caenorhabditis elegans 17493829  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00010410 9284893 9286405 -1

3 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrIV_9283114..9284892   1779 IV: 9283114-9284892 Caenorhabditis elegans

18 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rifampicin-Allantoin_upregulated
  Transcripts that showed significantly increased expression in nhr-114(gk849) comparing to wild type animals at L4 larva. DESeq2 1.26.0, fold change > 2, FDR < 0.05. WBPaper00064539:nhr-114(gk849)_upregulated
  Up-regulated genes (fold change > 1.5) in two CoQ-deficient clk-1 mutant strains (e2519, qm30) compared to wild types N2. Fold-changes of intensities were calculated from the arithmetic mean of gene expression values between experimental and corresponding control group. Fold change >= 1.5 was used as cut-off. WBPaper00045774:clk-1_upregulated
  Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014. N.A. WBPaper00026929:sir-2.1_overexpression_regulated
  Transcripts that showed significantly increased expression in mdt-15(tm2182) comparing to in N2 at L4 larva stage. p-value < 0.05, fold change > 2. WBPaper00065288:mdt-15(tm2182)_upregulated
  Transcripts down regulated in hpl-2(tm1489) embryo comparing to N2 in tiling array analysis. Oligos from the tiling array were mapped to chromosome coordinates of the exons from Wormbase WS180. Any oligo that mapped to a gene on both the Watson and Crick strands was excluded. The remaining oligos were then grouped together (perfect match and mismatch) into probe sets and written out into an Affymetrix CDF file. The CDF file was converted into an R-package and loaded into R. The expression values were calculated using the justRMA function from Bioconductor. This used a Benjamini and Hochberg false discovery rate correction. WBPaper00040560:hpl-2_embryo_downregulated
EtBr-exposed(maintained under normal lab light (mostly dark, in incubators) and exposed to EtBr (5ug/mL in agar).) vs UVC-exposed(exposed to 7.5 J/m2 UVC radiation 3 times, 24 h apart (48 h total).) at 3 h after the third UVC dose (51h), which is also 3 h after being placed on food. Genes differentially expressed under EtBr treatment without UVC exposure vs after UVC exposure but without EtBr treatment at the -3h timepoint (3 h after the third UVC dose (51h), which is also 3 h after being placed on food). Transcripts were defined as fold-change >1.2, p < 0.05 based on Rosetta Resolver analysis for all pairwise treatment comparisons. The fold-change refers to the second intensity over the first. WBPaper00041939:EtBr-exposed_vs_UVC-exposed_51h
Acidic Environment: PH 4.33 vs. PH 6.33. Transcripts that showed significantly increased expression after 3 hours of exposure to acidic environment (PH 4.33), comparing to control animals exposed to PH 6.33 environment. DESeq2 (1.16.1). The Benjamini and Hochberg's approach was used to adjust the resulting P-values to control the false discovery rate. Corrected value of P < 0.05 and fold change > 2 were set as the threshold for significantly differential expression. WBPaper00060434:pH4.33_vs_pH6.33_uprgulated
  Genes from N2 animals with significantly increased expression after 72 hours of treatment on growth media with 10uM rapamycin in 2% DMSO. Analysis of gene expression data was carried out with the Affymetrix Transcriptome Analysis Console. Data preprocessing (using RMA normalization) and QC metrics were performed using Affymetrix Expression Console TM and manually inspected afterwards. Expression analysis was carried out for each two pairwise conditions. FDR statistical correction for multiple testing resulted in a slightly lower number of DEGs in most cases. P-value < 0.05 and fold change > 2.0 were used to determine differentially expressed genes. WBPaper00048989:N2_rapamycin_upregulated
  Genes found to be regulated in daf-16(mgDf50) by resveratrol treatment with p < 0.01. N.A. WBPaper00026929:Resveratrol_regulated_daf-16
  Genes up regulated by mir-243(n4759). RNAs that changed at least 2-fold with a probability of p > 0.05 in three biological replicates were considered differentially regulated between wild-type and mir-243. WBPaper00036130:mir-243_up_regulated
  Genes in the bottom 10% of expression level across the triplicate L3 samples. To generate the top10 and bottom10 gene sets, authors ranked all genes by mean expression array signal intensity across the three replicates, then took the top and bottom deciles (1,841 genes each) to represent genes with high and low expression. To generate the top10 and bottom10 gene sets, authors ranked all genes by mean expression array signal intensity across the three replicates, then took the top and bottom deciles (1,841 genes each) to represent genes with high and low expression. WBPaper00032528:L3_depleted
  Transcripts that showed significantly increased expression in sek-1(km4) animals comparing to in N2 animals under both dietary (DR, OP50 OD = 0.1) and ad libtum (AL, OP50 OD = 3) conditions from 3-day post L4 till 6-day post L4 adult hermaphrodite stage. Bioconductor package edgeR, p < 0.05. WBPaper00056443:sek-1(km4)_upregulated
  Genes that showed significantly decreased expression level in rsr-2(RNAi) animals comparing to in gfp(RNAi) control. Fold change > 1.2 or < 0.8. WBPaper00042477:rsr-2(RNAi)_downregulated_TilingArray
UV irradiation: 10 mJ per square cm. Genes with significantly increased expression in xpa-1(ok698) animals after treated with 10mJ per square cm UV and harvested 6 hours later. Differentially expressed genes were determined by ANOVA analysis using the Partek software package. WBPaper00047070:xpa-1_UV_upregulated
  Genes that are upregulated by 0.2M ethanol treatment. Differences in gene expression levels between the two groups of worms were analyzed with Cufflinks 1.0.3, using a cutoff of twofold difference and FDR corrected p < 0.05. WBPaper00041954:ethanol_upregulated
  Genome-wide analysis of developmental and sex-regulated gene expression profile. self-organizing map cgc4489_group_7
  Genes specifically expressed in somatic tissue when comparing RNAseq data of N2 to glp-4(bn2ts). Authors extracted all genes with more than 25 mapped reads and computed fold changes for all gene loci between wild type and mutants. The group of genes with 4-fold up-regulation in wild type was considered to be specifically expressed in the germline, while genes with 4-fold down-regulation in wild type where assumed to be specific to somatic cell lineages. WBPaper00044760:somatic_specific

3 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Also expressed in (comments from author) : No comments. Strain: BC13008 [H22D14.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTATCGATTTCAGGCCAACC] 3' and primer B 5' [GTCTCTCTGCTTCCATTATTTGGT] 3'. Expr6280 Larval Expression: seam cells;  
Also expressed in (comments from author) : no GFP expression after early larval. Strain: BC13132 [H22D14.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTATCGATTTCAGGCCAACC] 3' and primer B 5' [GTCTCTCTGCTTCCATTATTTGGT] 3'. Expr6281 Larval Expression: seam cells;  
    Expr1153182 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  

7 GO Annotation

Annotation Extension Qualifier
  located_in
  involved_in
  enables
  enables
  enables
  enables
  enables

0 Homologues

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00010410 9284893 9286405 -1

7 Ontology Annotations

Annotation Extension Qualifier
  located_in
  involved_in
  enables
  enables
  enables
  enables
  enables

0 Regulates Expr Cluster

1 Sequence

Length
1513

1 Sequence Ontology Term

Identifier Name Description
gene  

2 Strains

WormBase ID
WBStrain00036609
WBStrain00036555

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrIV_9286406..9292295   5890 IV: 9286406-9292295 Caenorhabditis elegans