WormMine: Gene WBGene00011106

• WormBase Gene ID: WBGene00011106
• Gene Name: acl-5
• Sequence Name: R07E3.5
• Brief Description: acl-5 encode a glycerol-3-phosphate acyltransferase; ACL-5 proteins are predicted to function in phospholipid biosynthesis, and acl-5 expression is highly induced during dauer larval development; large-scale expression studies have reported acl-5 expression in body wall muscle and some unidentified cells in the head.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable acyltransferase activity, transferring groups other than amino-acyl groups. Predicted to be involved in lipid metabolic process. Located in endoplasmic reticulum. Expressed in head. Is an ortholog of human GPAT3 (glycerol-3-phosphate acyltransferase 3) and GPAT4 (glycerol-3-phosphate acyltransferase 4).
• Biotype: SO:0001217
• Genetic Position: X :1.96282 ±0.018278
• Length (nt): 3294

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00011106

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:R07E3.5a.1	R07E3.5a.1	1688	X: 10324163-10327456
Transcript:R07E3.5b.1	R07E3.5b.1	1368	X: 10324311-10326770

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:R07E3.5a	R07E3.5a	1539	X: 10324311-10324574
CDS:R07E3.5b	R07E3.5b	1368	X: 10324311-10324574

2 RNAi Result

• WBRNAi00051468
• WBRNAi00017549

73 Allele

• WBVar01928114
• WBVar01928115
• WBVar01928116
• gk964260
• gk962707
• WBVar01759121
• WBVar02065942
• WBVar02069060
• WBVar02027331
• WBVar02027330
• tm1506
• WBVar00082419
• WBVar00082412
• WBVar00082413
• WBVar00082415
• WBVar00082416
• WBVar00082421
• WBVar00082427
• WBVar01551777
• WBVar02034704
• WBVar01888735
• WBVar01888736
• gk428935
• gk500432
• gk850347
• gk632379
• gk878350
• WBVar00063134
• gk815639
• gk774944

1 Chromosome

• WormBase ID: X
• Organism: Caenorhabditis elegans
• Length (nt): 17718942

1 Chromosome Location

• Feature . Primary Identifier: WBGene00011106
• Start: 10324163
• End: 10327456
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrX_10321858..10324162
• Length (nt): 2305
• Chromosome Location: X: 10321858-10324162
• Organism: Caenorhabditis elegans

92 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_NoFood
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage.	edgeR, fold change > 2, FDR < 0.05	WBPaper00060909:atfs-1(cmh15)_downregulated
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_glp-1(e2141)
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_SM
	Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_downregulated
	Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals.	Sleuth	WBPaper00051558:aging_regulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts that showed differential expression between 24 and 26 hours post hatching L2d and dauer committed larvae of daf-9(dh6), triggered by the dafachronic acid (DA) growth hormone. Cluster 3 genes increased expression transiently at 26 hour post hatching.	Benjamini Hochberg corrected q-value < 0.01.	WBPaper00053388:dauer_regulated_Cluster3
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome
	Transcripts that showed significantly increased expression in xrep-4(lax137).	DESeq2. Genes were selected if their p value < 0.01.	WBPaper00066062:xrep-4(lax137)_upregulated
Temprature shift to 28C for 48 hours.	Transcripts that showed significantly decreased expression after animals were exposed to 28C temperature for 48 hours.	Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control.	WBPaper00061341:28C_48h_downregulated
	Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in N2.	Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1.	WBPaper00053810:daf-2(e1370)_upregulated
	Transcripts that showed significantly increased expression in dpy-21(e428) comparing to in N2 during L3 stage.	DESeq v1.6.3. Fold change > 1.5.	WBPaper00050370:dpy-21(e428)_L3_upregulated
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
	Transcripts that showed altered expression from P0 to F2 generation animals after N2 parental generation were treated with antimycin, but not in damt-1(gk961032) P0 to F2 animals after the parenal generaton were treated with antimycin.	N.A.	WBPaper00055862:antimycin_damt-1(gk961032)_regulated
	Transcripts that showed significantly decreased expression in the neurons of bcat-1(RNAi) animals at 5-days post L4 adult hermaphrodite stage, comparing to animals injected with empty vector.	DESeq2. FDR < 0.05.	WBPaper00060459:bcat-1(RNAi)_downregulated
	Proteins identified in extracellular vesicle.	N.A.	WBPaper00062669:extracellular-vesicle_protein
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(+), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(+)_vs_control_day2-adult
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(-), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(-)_vs_control_day2-adult
	Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014.	N.A.	WBPaper00026929:sir-2.1_overexpression_regulated
	Transcripts of coding genes that showed significantly increased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_enriched_coding-RNA
	Genes that showed decreased expression in nhr-8(hd117) comparing to N2.	Expression data were read in the statistical programming environment R and processed for background correction and quantile normalization and summarized for genes that differed in expression >= 1.5-fold (N2 versus nhr-8) and a p value <= 0.01 using the Limma package.	WBPaper00044030:nhr-8(hd117)_downregulated

7 Expression Patterns

• Primary Identifier: Expr2009156
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr6476
• Remark: Strain: BC10304
• Reporter Gene: [R07E3.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGAATTCATTGAAAGGTGGAA] 3' and primer B 5' [GGCAAAAACGAGGGAAAAC] 3'.
• Pattern: Adult Expression: body wall muscle; unidentified cells in head; Larval Expression: body wall muscle

• Primary Identifier: Expr1034880
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr2027393
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr10829
• Subcellular Localization: acl-5 colocalized with an ER marker (calnexin), but not with a mitochondrial marker (MitoTracker) when expressed in mammalian cells.

• Primary Identifier: Expr1013141
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1155155
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

6 GO Annotation

11 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00011106
• Start: 10324163
• End: 10327456
• Strand: -1

6 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 3294

1 Sequence Ontology Term

• Name: gene

1 Strains

• WBStrain00001269

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrX_10327457..10330538
• Length (nt): 3082
• Chromosome Location: X: 10327457-10330538
• Organism: Caenorhabditis elegans