WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00010974 Gene Name  bbs-5
Sequence Name  ? R01H10.6 Brief Description  bbs-5 encodes a novel protein that is the C. elegans ortholog of human BBS5; bbs-5 is required for the proper regulation of insulin secretion; bbs-5, bbs-1, bbs-8 and bbs-9 mutants along with ciliary phenotypes show an increased secretion of insulin, biogenic amines and neuropeptides which requires the Rab27/AEX-6 dense-core vesicle exocytosis machinery; a BBS-5::GFP reporter protein is expressed exclusively in ciliated neurons, where it localizes to the ciliary base; consistent with the presence of an X box in the bbs-5 5' UTR, bbs-5 expression is positively regulated by daf-19, a RFX-transcription factor.
Organism  Caenorhabditis elegans Automated Description  Predicted to enable phosphatidylinositol-3-phosphate binding activity. Predicted to be involved in cilium assembly and intracellular transport. Located in cilium. Expressed in head; neurons; outer labial neurons; and tail. Used to study Bardet-Biedl syndrome and ciliopathy. Human ortholog(s) of this gene implicated in Bardet-Biedl syndrome 5. Is an ortholog of human BBS5 (Bardet-Biedl syndrome 5).
Biotype  SO:0001217 Genetic Position  III :2.09797 ±0.013647
Length (nt)  ? 2952
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00010974

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:R01H10.6.1 R01H10.6.1 1251   III: 10258831-10261782
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:R01H10.6 R01H10.6 1086   III: 10258872-10259108

5 RNAi Result

WormBase ID
WBRNAi00051105
WBRNAi00051106
WBRNAi00017300
WBRNAi00007005
WBRNAi00034516

56 Allele

Public Name
gk964518
gk963887
WBVar02069703
WBVar01267592
gk944544
gk944546
gk944545
WBVar01827924
WBVar01827923
WBVar01827922
gk953038
gk879119
gk929196
gk919147
gk756072
gk485085
gk442943
gk563523
gk817481
gk572780
gk398279
gk607760
gk703314
gk403493
gk506004
gk643297
gk724347
gk727971
gk711170
gk883860

1 Chromosome

WormBase ID Organism Length (nt)
III Caenorhabditis elegans 13783801  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00010974 10258831 10261782 -1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrIII_10258742..10258830   89 III: 10258742-10258830 Caenorhabditis elegans

178 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells. DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction. WBPaper00060811:L1_vs_adult_upregulated_neural
  Transcripts of coding genes that showed significantly decreased expression in muscle. DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. WBPaper00062325:muscle_depleted_coding-RNA
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:all-neurons_L1-larva_expressed
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  Transcripts enriched in ASG according to single cell RNAseq. Genes that pass the Bonferroni threshold for multiple comparisons (q < 0.05) are significantly enriched. WBPaper00061651:ASG_enriched
Osmotic stress Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:OsmoticStress_regulated_Food
  Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology. DESEQ2, fold change > 2 and FDR < 0.01. WBPaper00062103:neuron_enriched
  Genes that showed increased expression in wdr-5(ok1417) comparing with in N2. Statistical analysis for misexpression was performed using a moderated t test from the package limma. All genes with a false discovery rate (FDR) of <= 5% (p <= 0.05) were selected as differentially regulated. WBPaper00045861:wdr-5(ok1417)_upregulated
  Single-cell RNA-Seq cell group 71_0 expressed in neuron. scVI 0.6.0 WBPaper00065841:71_0
  Transcripts that showed significantly increased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rapamycin-Metformin_upregulated
  Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:arcade_intestinal-valve_expressed
  Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
  Transcripts that showed significantly increased expression in hda-1(RNAi) embryos comparing to control animals. DESeq2, fold change > 2, FDR < 0.05. WBPaper00067044:hda-1(RNAi)_upregulated
  Transcripts detected in germline isolated from day-1 adult hermaphrodite animals. All three experiments have CPM >= 1. WBPaper00067147:germline_expressed
  Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2. DESeq2, fold change > 2, p-value < 0.01. WBPaper00061203:sin-3(tm1276)_upregulated
starvation 12 hours Transcripts that showed significantly increased expression in dissected intestines of N2 L1 larva that were starved for 12 hours, comparing to fed animals. EdgeR, FDR < 0.05, fold change >= 2. WBPaper00067259:starvation_upregulated_intestine
  Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals. Sleuth WBPaper00051558:aging_regulated
  Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage. DESeq WBPaper00053302:stavudine_24h_regulated
  Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult. DESeq2, fold change > 2, adjusted p-value < 0.01 WBPaper00058598:sin-3(tm1276)_downregulated
  Transcripts that showed significantly increased expression in isp-1(qm150) comparing to in N2. Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1. WBPaper00053810:isp-1(qm150)_upregulated
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:coelomocytes_L2-larva_expressed
  Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals. Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R. WBPaper00061479:hda-1(ne4752)_upregulated
  Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:dopaminergic-neurons_L3-L4-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:glr-1(+)-neurons_L2-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:PVD-OLL-neurons_L3-L4-larva_expressed
  Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals. DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2. WBPaper00062159:hda-2(ok1479)_upregulated
  Transcripts that showed significantly increased expression in srbc-48(ac23);kyIs262;fer-1(b232ts) comparing to in kyIs262;fer-1(b232ts), 24h after infection with P.aeruginosa. DESeq2, FDR <0.05, fold change > 2. WBPaper00059664:srbc-48(ac23)_upregulated
  Transcripts that showed significantly altered expression in rnp-6(dh1127) animals comparing to in N2 when fed with heat killed E. coli OP50. Differentially expressed genes (DEGs) (q-value <0.05) between different samples were identified using the stringtie version 1.3.0, followed by Cufflinks version 2.2. WBPaper00059824:rnp-6(dh1127)_regulated_OP50
  Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage. DESeq2, fold change > 2, FDR < 0.05. WBPaper00066594:ilc-17.1(syb5296)_upregulated

10 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr2009573 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
Strain: BC13013 [R01H10.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGTGCTGAGAGAGACTTGTGG] 3' and primer B 5' [CGATTGGAAGAAATGGGCT] 3'. Expr6443 Adult Expression: Nervous System; head neurons; amphids; tail neurons; phasmids; unidentified cells in head; unidentified cells in tail ; Larval Expression: Nervous System; head neurons; amphids; tail neurons; phasmids; unidentified cells in head; unidentified cells in tail ;  
    Expr141 Typically one or two neuronal nuclei around the isthmus of the pharynx are observed in 3-fold embryos and young larvae. These nuclei are less frequently observed in older larvae and adults.  
    Expr1034810 Tiling arrays expression graphs  
Promoter::GFP fusion constructs of variable lengths were generated using PCR amplification followed by subsequent cloning into expression vectors.   Expr10105 Expressed in both the amphid and tail ciliated sensory neurons. The 60 C. elegans CSNs present in an adult hermaphrodite worm were divided into 5 subgroups or anatomical regions including, neurons that reside in the amphids (region 1 = 24 CSNs: AWAL/R, AWBL/R, AWCL/R, AFDL/R, ASEL/R, ADFL/R, ASGL/R, ASHL/R, ASIL/R, ASJLR, ASKL/R, ADLL/R) or in the tail (region 2 = 5 CSNs: PHAL/R, PHBL/R, PQR), neurons surrounding the anterior bulb (region 3 = 24 CSNs: BAGL/ R, CEPVL/R, CEPDL/R, IL1L/R, IL2L/R, IL1VL/R, IL2VL/R, IL1DL/R, IL2DL/R, OLLL/R, OLQVL/R, OLQDL/R) or the posterior bulb (region 4 = 5 CSNs: ADEL/R, FLPL/R, AQR) of the pharynx, and neurons in the midbody region of the worm (region 5=2 CSNs: PDEL/R). bbs-5 was detected in all 5 regions.  
    Expr2968 GFP fluorescence was detected in all ciliated sensory neurons including the amphids, labial neurons, phasmids, and the sensory rays of the male tail. No GFP was evident in other cell types, suggesting that bbs-5 expression is restricted to ciliated cells. Analysis of a C. elegans strain expressing a translational bbs-5::GFP transgene revealed that the GFP-tagged BBS-5 protein localizes specifically to the base of cilia in the ciliated head and tail neurons. BBS-5::GFP staining pattern is observed at the base of the cilia in the amphid neurons in the worm head and at the base of the left and right phasmid neurons in the tail.
    Expr2027810 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1012655 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Original chronogram file: chronogram.398.xml [R01H10.6:gfp] transcriptional fusion. Chronogram1523    
    Expr1154812 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  

24 GO Annotation

Annotation Extension Qualifier
  involved_in
  involved_in
  involved_in
  enables
  located_in
  located_in
  located_in
  located_in
  located_in
  located_in
  involved_in
  involved_in
  located_in
  located_in
  located_in
  located_in
  located_in
  located_in
  located_in
  located_in
  part_of
  part_of
  part_of
  located_in

5 Homologues

Type
least diverged orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00010974 10258831 10261782 -1

24 Ontology Annotations

Annotation Extension Qualifier
  involved_in
  involved_in
  involved_in
  enables
  located_in
  located_in
  located_in
  located_in
  located_in
  located_in
  involved_in
  involved_in
  located_in
  located_in
  located_in
  located_in
  located_in
  located_in
  located_in
  located_in
  part_of
  part_of
  part_of
  located_in

0 Regulates Expr Cluster

1 Sequence

Length
2952

1 Sequence Ontology Term

Identifier Name Description
gene  

4 Strains

WormBase ID
WBStrain00036334
WBStrain00036508
WBStrain00002453
WBStrain00002452

0 Upstream Intergenic Region