WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00012288 Gene Name  sre-32
Sequence Name  ? W05H5.7 Organism  Caenorhabditis elegans
Automated Description  Predicted to be involved in sensory perception of chemical stimulus. Predicted to be located in membrane. Biotype  SO:0001217
Genetic Position  II :9.95401 ±0.00935 Length (nt)  ? 1780
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00012288

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:W05H5.7.1 W05H5.7.1 1116   II: 12454954-12456733
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:W05H5.7 W05H5.7 1086   II: 12454984-12455191

3 RNAi Result

WormBase ID
WBRNAi00054845
WBRNAi00019634
WBRNAi00036311

49 Allele

Public Name
gk963801
gk963053
gk962684
gk964116
WBVar01605550
WBVar01379215
otn14588
otn14589
WBVar01983061
WBVar01384433
WBVar01836301
WBVar02014354
gk157280
gk157279
gk157281
WBVar01259206
tm8619
gk662667
gk570297
gk931491
WBVar01685479
WBVar01685478
WBVar01685481
WBVar01685480
WBVar01247611
WBVar01247612
gk935526
gk488602
gk747947
gk733591

1 Chromosome

WormBase ID Organism Length (nt)
II Caenorhabditis elegans 15279421  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00012288 12454954 12456733 -1

3 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrII_12454694..12454953   260 II: 12454694-12454953 Caenorhabditis elegans

28 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology. DESEQ2, fold change > 2 and FDR < 0.01. WBPaper00062103:neuron_enriched
  Upregulated mRNAs and lncRNAs in dot-1.1(knu339); ced-3(n1286) relative to ced-3(n1286). edgeR, fold change > 2, FDR < 0.05. WBPaper00065759:dot-1.1(knu339)_upregulated
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 0hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:germline-precursors_blastula-embryo_expressed
  Transcripts that showed significantly decreased expression in eat-2(ad1116) comparing to in N2 at 3-days post L4 adult hermaphrodite animals. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:eat-2(ad1116)_downregulated
  Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 50uM Rifampicin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rapamycin-Rifampicin_downregulated
  Transcripts that showed significantly increased expression in cfp-1(tm6369) comparing to in N2 at early embryo stage. DESeq2, FDR < 0.05 WBPaper00058691:cfp-1(tm6369)_upregulated
  Transcripts that showed significantly increased expression in set-2(tm1630) animals at embryo stage, comparing to in N2 animals. DESeq2 (v2.1.8.3) was used to determine DE genes and to generate principal component and scatter plots. DE genes with FDR < 0.05 were analysed using g:Profiler with Bonferroni correction. WBPaper00060014:set-2(tm1630)_upregulated
  Transcripts that showed significantly increased expression in set-2(zr2012) animals at embryo stage, comparing to in N2 animals. DESeq2 (v2.1.8.3) was used to determine DE genes and to generate principal component and scatter plots. DE genes with FDR < 0.05 were analysed using g:Profiler with Bonferroni correction. WBPaper00060014:set-2(zr2012)_upregulated
Temprature shift to 28C for 24 hours. Transcripts that showed significantly increased expression after animals were exposed to 28C temperature for 24 hours. Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control. WBPaper00061341:28C_24h_upregulated
Temprature shift to 28C for 48 hours. Transcripts that showed significantly increased expression after animals were exposed to 28C temperature for 48 hours. Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control. WBPaper00061341:28C_48h_upregulated
  Transcripts that showed significantly increased expression in daf-2(e1370) neurons comparing to in N2 neurons at day 8adult stage. DESeq2, FDR < 0.05, fold change > 2. WBPaper00066978:daf-2(e1370)_upregulated_neuron
  Transcripts that showed significantly increased expression in daf-16(mu86);daf-2(e1370) neurons comparing to in daf-2(e1370) neurons at day 8adult stage. DESeq2, FDR < 0.05, fold change > 2. WBPaper00066978:daf-16(mu86)_upregulated_neuron
  Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin, 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rapamycin-Rifampicin-Allantoin_downregulated
Fungi infection: Harposporium sp. Genes with decreased expression after 24 hours of infection by Harposporium Fold changes shown are pathogen vs OP50. For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. WBPaper00038438:Harposporium_24hr_downregulated_RNAseq
  Transcripts that showed significantly decreased expression after animals were treated with 50uM Rifampicin and 100uM Psora from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rifampicin-Psora_downregulated
Fungi infection: Drechmeria coniospora Genes with increased expression after 12 hours of infection by D.coniospora Fold changes shown are pathogen vs OP50. For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. WBPaper00038438:D.coniospora_12hr_upregulated_RNAseq
  Transcripts that showed significantly increased expression in mex-1(or286) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult. RPKM fold change > 2. WBPaper00058598:mex-1(or286)_upregulated
  Transcripts that showed significantly increased expression in mex-3(eu149) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult. RPKM fold change > 2. WBPaper00058598:mex-3(eu149)_upregulated
  Transcripts that showed significantly increased expression in spn-4(tm291) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult. RPKM fold change > 2. WBPaper00058598:spn-4(tm291)_upregulated
  Genes that showed significantly increased expression level in rsr-2(RNAi) animals comparing to in gfp(RNAi) control. Fold change > 1.2 or < 0.8. WBPaper00042477:rsr-2(RNAi)_upregulated_TilingArray
  Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin, 50uM Rifampicin and 100uM Psora from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rapamycin-Rifampicin-Psora_downregulated
  Genes that showed significantly increased expression after exposure to adsorbable organic bromine compounds (AOBr) contained in M. aeruginosa batch culture. Differentially expressed genes (DEGs) were identified with a random variance t-test and a significance analysis of microarrays (SAM) test. Genes were considered statistically significant if their p-value was less than 0.05, the false discovery rate less than 0.3, and the fold change compared to control at least <= 0.67 or >=1.5. WBPaper00046853:AOBr_M.aeruginosa-batch-culture_upregulated
  Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin, 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rapamycin-Psora-Allantoin_downregulated
  Coexpression clique No. 211, srj-42-srw-113, on the genome-wide coexpression clique map for the nematode GPL200 platform. All available microarray datasets for the GPL200 platform (Affymetrix C. elegans Genome Array) were obtained from the GEO repository. This included 2243 individual microarray experiments. These were normalized against each other with the software RMAexpress (Bolstad, 2014). Based on these normalized values, Pearsons correlation coefficients were obtained for each probe-probe pair of the 22,620 probes represented on this array type. The resulting list of correlation coefficients was then ranked to generate the ranked coexpression database with information on each probe represented on the GPL200 platform. WBPaper00061527:srj-42-srw-113
  Genes from N2 animals with significantly increased expression after 72 hours of treatment on growth media with 250uM allantoin in 2% DMSO. Analysis of gene expression data was carried out with the Affymetrix Transcriptome Analysis Console. Data preprocessing (using RMA normalization) and QC metrics were performed using Affymetrix Expression Console TM and manually inspected afterwards. Expression analysis was carried out for each two pairwise conditions. FDR statistical correction for multiple testing resulted in a slightly lower number of DEGs in most cases. P-value < 0.05 and fold change > 2.0 were used to determine differentially expressed genes. WBPaper00048989:N2_allantoin_upregulated
  Transcripts that showed significantly increased expression in drh-3(rrr2) comparing to in N2. edgeR, log2 fold change > 2 or < -2. WBPaper00053888:drh-3(rrr2)_upregulated
  Top 300 transcripts enriched in pm7 according to single cell RNAseq. Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm. WBPaper00061340:pm7

6 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr2034510 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
Also expressed in (comments from author) : No comments. Strain: BC14727 [sre-32::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGAGGCGCAAAGAAATTGG] 3' and primer B 5' [TTTATAATGATTTTCCGGGTGG] 3'. Expr6841 Adult Expression: intestine; Nervous System; head neurons; Larval Expression: intestine; Nervous System; head neurons;  
    Expr1158389 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr2016283 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr14043 Couple of neurons in head and tail (sick strain, very low penetrance)  
    Expr1024105 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

4 GO Annotation

Annotation Extension Qualifier
  located_in
  located_in
  located_in
  involved_in

0 Homologues

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00012288 12454954 12456733 -1

4 Ontology Annotations

Annotation Extension Qualifier
  located_in
  located_in
  located_in
  involved_in

0 Regulates Expr Cluster

1 Sequence

Length
1780

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrII_12456734..12457574   841 II: 12456734-12457574 Caenorhabditis elegans