WormMine: Gene WBGene00012497

• WormBase Gene ID: WBGene00012497
• Gene Name: ragc-1
• Sequence Name: Y24F12A.2
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable GTP binding activity and GTPase activity. Involved in determination of adult lifespan and regulation of autophagosome assembly. Predicted to be located in lysosome and nucleus. Predicted to be part of Gtr1-Gtr2 GTPase complex. Human ortholog(s) of this gene implicated in primary hypomagnesemia. Is an ortholog of human RRAGC (Ras related GTP binding C) and RRAGD (Ras related GTP binding D).
• Biotype: SO:0001217
• Genetic Position: IV :5.04207 ±0.006672
• Length (nt): 1321

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00012497

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:Y24F12A.2a.1	Y24F12A.2a.1	1101	IV: 11603613-11604933
Transcript:Y24F12A.2b.1	Y24F12A.2b.1	291	IV: 11603688-11604026

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:Y24F12A.2b	Y24F12A.2b	291	IV: 11603688-11603913
CDS:Y24F12A.2a	Y24F12A.2a	1017	IV: 11603688-11603913

9 RNAi Result

• WBRNAi00055725
• WBRNAi00055726
• WBRNAi00020132
• WBRNAi00026630
• WBRNAi00026631
• WBRNAi00036734
• WBRNAi00027510
• WBRNAi00062504
• WBRNAi00090957

24 Allele

• gk964278
• gk964078
• gk964500
• gk962765
• tm11221
• WBVar02121030
• WBVar02121776
• WBVar02122611
• WBVar02123094
• WBVar02121622
• tm1974
• gk683220
• gk644367
• gk316008
• gk702906
• gk864942
• gk704806
• gk403583
• gk742211
• WBVar00052967
• WBVar02008304
• gk560663
• gk564141
• gk434711

1 Chromosome

• WormBase ID: IV
• Organism: Caenorhabditis elegans
• Length (nt): 17493829

1 Chromosome Location

• Feature . Primary Identifier: WBGene00012497
• Start: 11603613
• End: 11604933
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrIV_11603281..11603612
• Length (nt): 332
• Chromosome Location: IV: 11603281-11603612
• Organism: Caenorhabditis elegans

100 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_SM
	Transcripts that showed significantly increased expression in 10-days post L4 adult hermaphrodite N2 grown at 20C, comparing to in 1-day post L4 adult hermaphrodite N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:Day10_vs_Day1_upregulated
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome
	Transcripts that showed significantly decreased expression in tetraploid N2 comparing to diploid N2 animals at L4 larva stage.	DESeq2 R package (1.20.0), fold change > 2, and FDR < 0.05.	WBPaper00066110:tetraploid_vs_diploid_downregulated
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
	Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis.	To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq.	WBPaper00045521:Gender_Neutral
	Transcripts that showed decreased expression in hlh-11(ko1) knockout strain comparing to in wild type background.	DESeq2, FDR < 0.05	WBPaper00060683:hlh-11(ko1)_downregulated
Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours.	Transcripts that showed significantly decreased expression in hpx-2(dg047) after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50.	Cuffcompare and Cuffdiff	WBPaper00056090:E.faecalis_downregulated_hpx-2(dg047)
	Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014.	N.A.	WBPaper00026929:sir-2.1_overexpression_regulated
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_downregulated
	Transcripts that showed significantly increased expression in set-2(tm1630) animals at embryo stage, comparing to in N2 animals.	DESeq2 (v2.1.8.3) was used to determine DE genes and to generate principal component and scatter plots. DE genes with FDR < 0.05 were analysed using g:Profiler with Bonferroni correction.	WBPaper00060014:set-2(tm1630)_upregulated
	Genes expressed in N2.	Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0.	WBPaper00025141:N2_Expressed_Genes
	Transcripts that showed significantly decreased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_downregulated
	Transcripts that showed significantly decreased expression in hsf-1(RNAi) animals comparing to in control animals, without heat shock.	Transcripts that were differentially expressed in different conditions, compared to the hsf-1(+);-HS control, were determined with CuffDiff, which uses the Benjamini-Hochberg correction for multiple testing to obtain the q-value (the FDR-adjusted the p-value).	WBPaper00049942:hsf-1(RNAi)_downregulated
	Transcripts that showed significantly decreased expression in pals-22(jy3) comparing to in N2 at L4 larva stage.	Differential expression analysis was performed in RStudio (v1.1.453) using R (v3.50) and Bioconductor (v3.7) packages. As outlined in the RNAseq123 vignette, data was imported, filtered and normalized using edgeR, and linear modeling and differential expression analysis was performed using limma. An FDR cutoff of <0.01 was used to define differentially expressed genes; no fold-change criteria was used.	WBPaper00056034:pals-22(jy3)_downregulated
	Transcripts enriched in germline by comparing dissected germline tissue with dissected intestine tissue, both injected with empty RNAi vector.	Genes were determined germline-enriched if the lowest expression value (log2(FPKM+1)) observed in the germline empty vector samples was at least 2-fold higher than the highest expression value observed in the intestine empty vector samples.	WBPaper00051039:germline_enriched
Bacteria infection: Xenorhabdus nematophila	Caenorhabditis elegans Genes with expression levels changed significantly after treatment of Xenorhabdus nematophila.	Differential expression were calculated by empirical eBayes method using eBayes function. P_value <= 0.01 and log2 fold change > 1 were used to call differentially expressed genes in all datasets.	WBPaper00041606:CE_X.nematophila_regulated

7 Expression Patterns

• Primary Identifier: Expr6910
• Remark: Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC11848
• Reporter Gene: [Y24F12A.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCTTTGAGTAGTTGACCACTGTTG] 3' and primer B 5' [CTCGATTCTGAAATTGAAAAGGTT] 3'.
• Pattern: Adult Expression: intestine; Larval Expression: intestine

• Primary Identifier: Expr1035537
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr1159247
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2033480
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr2015246
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Chronogram918
• Remark: Original chronogram file: chronogram.1966.xml
• Reporter Gene: [Y24F12A.2:gfp] transcriptional fusion.

• Primary Identifier: Expr1015898
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

15 GO Annotation

9 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00012497
• Start: 11603613
• End: 11604933
• Strand: -1

15 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 1321

1 Sequence Ontology Term

• Name: gene

1 Strains

• WBStrain00001910

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrIV_11604934..11605253
• Length (nt): 320
• Chromosome Location: IV: 11604934-11605253
• Organism: Caenorhabditis elegans