WormMine: Gene WBGene00011480

• WormBase Gene ID: WBGene00011480
• Gene Name: enpl-1
• Sequence Name: T05E11.3
• Brief Description: enpl-1 encodes the C. elegans ortholog of the Hsp90 family member and endoplasmic reticulum (ER) chaperone GRP94/GP96; loss of enpl-1 activity via RNAi results in slow growth, larval arrest, uncoordinated locomotion, and weak endocytosis defects; in addition, loss of enpl-1 expression results in an increase in hsp-4 expression, revealing compensatory regulation amongst ER chaperones; an enpl-1::gfp reporter fusion is expressed in the pharynx, with large-scale expression studies reporting additional expression in the intestine and several unidentified cells in the head.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable ATP binding activity; ATP hydrolysis activity; and unfolded protein binding activity. Predicted to be involved in ERAD pathway and protein folding. Predicted to be located in endoplasmic reticulum and perinuclear region of cytoplasm. Expressed in head; neurons; pharynx; and vulva. Used to study cardiovascular system disease. Human ortholog(s) of this gene implicated in lung adenocarcinoma. Is an ortholog of human HSP90B1 (heat shock protein 90 beta family member 1).
• Biotype: SO:0001217
• Genetic Position: IV :4.89065±
• Length (nt): 3858

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00011480

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:T05E11.3a.1	T05E11.3a.1	2653	IV: 11119298-11123155
Transcript:T05E11.3a.2	T05E11.3a.2	2488	IV: 11119344-11123125
Transcript:T05E11.3b.1	T05E11.3b.1	2067	IV: 11120732-11122938

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:T05E11.3a	T05E11.3a	2283	IV: 11119451-11119496
CDS:T05E11.3b	T05E11.3b	2067	IV: 11120732-11121649

14 RNAi Result

• WBRNAi00052512
• WBRNAi00026194
• WBRNAi00106357
• WBRNAi00091958
• WBRNAi00076650
• WBRNAi00080555
• WBRNAi00035203
• WBRNAi00082878
• WBRNAi00071460
• WBRNAi00052511
• WBRNAi00009118
• WBRNAi00091957
• WBRNAi00065370
• WBRNAi00080487

44 Allele

• gk964278
• gk964078
• gk964500
• gk962765
• gk954044
• tm3738
• WBVar00191933
• WBVar01454142
• WBVar01454141
• gk498609
• gk794167
• gk502762
• gk321888
• WBVar01569743
• gk437321
• WBVar00270757
• WBVar01857780
• WBVar01857781
• ok1964
• gk440548
• gk212089
• gk681692
• gk212090
• gk550541
• gk212087
• gk639872
• gk212088
• gk853666
• gk839547
• gk702905

1 Chromosome

• WormBase ID: IV
• Organism: Caenorhabditis elegans
• Length (nt): 17493829

1 Chromosome Location

• Feature . Primary Identifier: WBGene00011480
• Start: 11119298
• End: 11123155
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

238 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	oocyte proteins identified by two or more unique peptides during proteomics study.	In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide.	WBPaper00038289:oocyte_protein
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_NoFood
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin-Allantoin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Psora-Allantoin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Metformin_upregulated
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage.	edgeR, fold change > 2, FDR < 0.05	WBPaper00060909:atfs-1(cmh15)_downregulated
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Transcripts that showed significantly increased expression in mrg-1(qa6200) comparing to in control animals in primordial germ cells (PGCs) at L1 larva stage.	DESeq2(v1.32.0), FDR < 0.05.	WBPaper00064315:mrg-1(qa6200)_upregulated_PGCs
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts depleted in purified oocyte P bodies comparing to in whole oocytes.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_oocyte_depleted
	Transcripts that showed significantly increased expression in sftb-1(cer6) deletion homozygous comparing to to in N2 animals at L4 larva stage.	DESeq2, fold change > 2	WBPaper00058725:sftb-1(cer6)_downregulated
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome

10 Expression Patterns

• Primary Identifier: Expr6617
• Remark: Also expressed in (comments from author) : No comments. Strain: BC10514
• Reporter Gene: [T05E11.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTGATTTTCTGAATGACATTTG] 3' and primer B 5' [GTCTCTTCCTAACGACCGAGAA] 3'.
• Pattern: Adult Expression: pharynx; intestine; Larval Expression: pharynx; intestine; unidentified cells in head

• Primary Identifier: Expr15278
• Pattern: ENPL-1::sfGFP was broadly expressed throughout the animal, with strong expression in neurons, vulva, germline and intestines. To confirm the neuronal localization of ENPL-1, we co-expressed ENPL-1::sfGFP with a pan neural nuclear RFP and showed that ENPL-1::sfGFP is present in a peri-nuclear pattern characteristic of the ER. Furthermore, the expression of ENPL-1 was also observed at the early developmental stages in the embryo.

• Primary Identifier: Expr1791
• Pattern: Expressed in pharynx.

• Primary Identifier: Expr2011320
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1021911
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1035052
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr15293
• Subcellular Localization: Confocal analysis of ENPL-1::sfGFP worms co-expressing the mCherry tagged rough endoplasmic reticulum (ER) specific marker, SP12(spcs-1) indicated that, as expected, ENPL-1 localized to the ER. Mammalian ENPL-1 homologs are found in non-ER locations in addition to the ER localization (Frasson et al., 2009; Patel et al., 2013). To ask whether this was the case for the worm ENPL-1, we used retrograde back filling of DiI into amphid neurons (Tong and Bürglin, 2010). We found that ENPL-1::sfGFP was present in the cell bodies of these neurons, where the rough ER and Golgi are found (Rolls et al., 2002), as well as in axons and dendrites, where there is no rough ER and Golgi. To further characterize the subcellular distribution of ENPL-1::sfGFP, we performed the differential ultracentrifugation followed by western blotting, to separate and analyze membrane and cytoplasmic fractions. We discovered that the ENPL-1::sfGFP is present in both the membrane and cytosolic fractions. Our analysis indicated that the ENPL-1 is found mainly in the ER lumen, however a fraction of the protein is present outside of the ER.

• Primary Identifier: Expr1156136
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Chronogram787
• Remark: Original chronogram file: chronogram.1827.xml
• Reporter Gene: [T05E11.3:gfp] transcriptional fusion.

• Primary Identifier: Expr2029556
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

16 GO Annotation

6 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00011480
• Start: 11119298
• End: 11123155
• Strand: 1

16 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 3858

1 Sequence Ontology Term

• Name: gene

1 Strains

• WBStrain00037295

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrIV_11118888..11119297
• Length (nt): 410
• Chromosome Location: IV: 11118888-11119297
• Organism: Caenorhabditis elegans