WormMine: Gene WBGene00012707

• WormBase Gene ID: WBGene00012707
• Gene Name: sre-16
• Sequence Name: Y39C12A.5
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to be involved in sensory perception of chemical stimulus. Predicted to be located in membrane. Expressed in head.
• Biotype: SO:0001217
• Genetic Position: IV :5.81085 ±0.00115
• Length (nt): 2027

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00012707

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:Y39C12A.5.1	Y39C12A.5.1	1068	IV: 12234085-12236111

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:Y39C12A.5	Y39C12A.5	1014	IV: 12234139-12234315

3 RNAi Result

• WBRNAi00056220
• WBRNAi00020396
• WBRNAi00111012

30 Allele

• gk964278
• gk964078
• gk964500
• gk962765
• gk964475
• gk964320
• tm8653
• h8534
• tm4952
• WBVar01795704
• WBVar00602803
• WBVar01731286
• tm5644
• gk214201
• WBVar01859178
• WBVar01859179
• gk214199
• ttTi41506
• gk214200
• WBVar01454476
• gk856443
• gk475723
• gk731659
• WBVar01454478
• gk535678
• WBVar01454477
• gk657399
• gk932655
• gk917103
• gk810878

1 Chromosome

• WormBase ID: IV
• Organism: Caenorhabditis elegans
• Length (nt): 17493829

1 Chromosome Location

• Feature . Primary Identifier: WBGene00012707
• Start: 12234085
• End: 12236111
• Strand: -1

3 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrIV_12233409..12234084
• Length (nt): 676
• Chromosome Location: IV: 12233409-12234084
• Organism: Caenorhabditis elegans

42 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
	Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc).	DESeq2, fold change >= 2, FDR <= 0.01.	WBPaper00056826:SGP_biased
	Transcripts that showed significantly increased expression in 10-days post L4 adult hermaphrodite N2 grown at 20C, comparing to in 1-day post L4 adult hermaphrodite N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:Day10_vs_Day1_upregulated
Temprature shift to 28C for 48 hours.	Transcripts that showed significantly decreased expression after animals were exposed to 28C temperature for 48 hours.	Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control.	WBPaper00061341:28C_48h_downregulated
	Transcripts that showed significantly decreased expression in hpl-2(tm1489) comparing to in N2 animals.	DESeq2, adjusted p-value < 0.05, log2 fold change > 2 or < -2.	WBPaper00054493:hpl-2(tm1489)_downregulated
	Transcripts that showed significantly increased expression in BAT525 [hmg-3 (tm2539) / dpy-5(e61) unc-13(e1091) I.] comparing to in N2 at 1-day post L4 adult hermaphrodite stage.	DESeq 2, fold change > 4, adjusted p-value < 0.05.	WBPaper00055013:hmg-3(bar24)_upregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Psora-Allantoin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Allantoin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Metformin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Rifampicin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin-Allantoin_downregulated
	Genes with significantly increased expression in eat-2(ad465) treated with 2% DMSO for 72 hours, comparing to in N2 treated with 2% DMSO for 72 hours.	Analysis of gene expression data was carried out with the Affymetrix Transcriptome Analysis Console. Data preprocessing (using RMA normalization) and QC metrics were performed using Affymetrix Expression Console TM and manually inspected afterwards. Expression analysis was carried out for each two pairwise conditions. FDR statistical correction for multiple testing resulted in a slightly lower number of DEGs in most cases. P-value < 0.05 and fold change > 2.0 were used to determine differentially expressed genes.	WBPaper00048989:eat-2(ad465)_upregulated_in-DMSO
	Transcripts that showed significantly increased expression in daf-2(e1370) neurons comparing to in N2 neurons at day 8adult stage.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00066978:daf-2(e1370)_upregulated_neuron
	Transcripts that showed significantly increased expression in daf-16(mu86);daf-2(e1370) neurons comparing to in daf-2(e1370) neurons at day 8adult stage.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00066978:daf-16(mu86)_upregulated_neuron
Acidic Environment: PH 4.33 vs. PH 6.33.	Transcripts that showed significantly increased expression after 3 hours of exposure to acidic environment (PH 4.33), comparing to control animals exposed to PH 6.33 environment.	DESeq2 (1.16.1). The Benjamini and Hochberg's approach was used to adjust the resulting P-values to control the false discovery rate. Corrected value of P < 0.05 and fold change > 2 were set as the threshold for significantly differential expression.	WBPaper00060434:pH4.33_vs_pH6.33_uprgulated
	Genome-wide analysis of developmental and sex-regulated gene expression profile.	self-organizing map	cgc4489_group_11
	Transcripts up regulated in daf-2(e1370) comparing to in N2 when animals were grown at 15 degree and then at 25 degree for 12 hours.	To select nuclear-hormone-receptor mutants for the cold-tolerance test, authors set the q-value threshold at q < 0.05, except that nhr-88, 113, 145, 172 and 207 were picked up from the genes with q < 0.25 in comparing between 15C-cultivated wild-type and wild-type cultivated at 25C for 12 h after cultivation at 15C.	WBPaper00049736:daf-2(e1370)_upregulated_15deg-then-25deg(12hr)
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin, 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Rifampicin-Allantoin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin_downregulated
	siRNAs that showed significantly lower expression (log2fold > 2, padj < 0.01) in hermaphrodite gonad (somatic gonad plus germine) than in male gonad (somatic gonad plus germine).	DESeq2 v1.13.8, fold change > 2, FDR < 0.01.	WBPaper00056161:male_enriched_siRNA
Wounding: 2 hours after a single stab of a microinjection needle to either anterior or posterior body of lateral hyp7 (avoid the gonad) 24 hr after the L4 stage.	Transcripts that showed significantly increased expression 2 hours after animals had a single stab of a microinjection needle to either anterior or posterior body of lateral hyp7 (avoid the gonad) 24 hr after the L4 stage.	The cutoff for differential expressed genes (DEGs) were: Benjamini-Hochberg adjustedP-valueless than 0.05 and fold change larger than 1.5.	WBPaper00059987:Wounding_upregulated
	Transcripts that showed significantly increased expression in Day 8 adults comparing to in Day 1 adults in neuron cells.	t-test, fold change > 2, p-value < 0.01.	WBPaper00062590:Aging_upregulated_neuron
	Transcripts that showed significantly increased expression in mex-3(eu149) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	RPKM fold change > 2.	WBPaper00058598:mex-3(eu149)_upregulated
	Genes from eat-2(ad465) animals with significantly decreased expression after 72 hours of treatment on growth media with 10uM rapamycin in 2% DMSO.	Analysis of gene expression data was carried out with the Affymetrix Transcriptome Analysis Console. Data preprocessing (using RMA normalization) and QC metrics were performed using Affymetrix Expression Console TM and manually inspected afterwards. Expression analysis was carried out for each two pairwise conditions. FDR statistical correction for multiple testing resulted in a slightly lower number of DEGs in most cases. P-value < 0.05 and fold change > 2.0 were used to determine differentially expressed genes.	WBPaper00048989:eat-2(ad465)_rapamycin_downregulated
	Genes up-regulated after 24 hour exposure to colistin.	Gene lists were created using a cutoff P-value of < 0.05, 2-fold change.	WBPaper00045673:colistin_upregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin, 50uM Rifampicin and 100uM Psora from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Rifampicin-Psora_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin, 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Psora-Allantoin_downregulated
	Transcripts that showed significantly increased expression in natural variant RC301(that showed resistance towards bacteria infection) vs. natural variant DA650, after 4 hour of infection by P. aeruginosa PA14.	Fold change > 2, p-value < 0.05.	WBPaper00050712:RC301_vs_DA650_4h-PA_upregulated

5 Expression Patterns

• Primary Identifier: Expr2034499
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr6953
• Remark: Strain: BC12195
• Reporter Gene: [Y39C12A.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCTCAAAATATTTAATCTGGGTCG] 3' and primer B 5' [CGATTATTTCAGAGGAAAATATGC] 3'.
• Pattern: Adult Expression: intestine; unidentified cells in head; Larval Expression: intestine; Nervous System; head neurons

• Primary Identifier: Expr1159710
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr1025271
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2016270
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

4 GO Annotation

0 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00012707
• Start: 12234085
• End: 12236111
• Strand: -1

4 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 2027

1 Sequence Ontology Term

• Name: gene

1 Strains

• WBStrain00002057

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrIV_12236112..12237174
• Length (nt): 1063
• Chromosome Location: IV: 12236112-12237174
• Organism: Caenorhabditis elegans