WormMine: Gene WBGene00013147

• WormBase Gene ID: WBGene00013147
• Gene Name: eyg-1
• Sequence Name: Y53C12C.1
• Brief Description: eyg-1 encodes a divergent PAIRED (PRD) class homeodomain protein; within the PRD class of homeobox genes, it belongs to the Eyg (eyegone) family of PRD homeobox genes that has been lost in vertebrates; eyg-1 lost the first half of the Paired domain and only retained the second half (RED subdomain); it has no obvious function in mass RNAi assays.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Predicted to be involved in regulation of transcription by RNA polymerase II. Predicted to be located in nucleus. Expressed in head and pharynx.
• Biotype: SO:0001217
• Genetic Position: II :1.72513 ±0.00035
• Length (nt): 1505

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00013147

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:Y53C12C.1.1	Y53C12C.1.1	1036	II: 9826448-9827952

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:Y53C12C.1	Y53C12C.1	945	II: 9826513-9826820

4 RNAi Result

• WBRNAi00057260
• WBRNAi00020916
• WBRNAi00037408
• WBRNAi00107338

38 Allele

• gk963801
• gk963053
• gk962682
• gk963142
• gk963818
• WBVar01439219
• WBVar01439220
• otn2787
• WBVar02121959
• otn1434
• gk851
• gk819
• tm3685
• WBVar02124393
• WBVar02120941
• WBVar02124943
• WBVar02122103
• WBVar02120798
• WBVar01817673
• gk788876
• gk928248
• gk774472
• gk776339
• gk645685
• gk571312
• gk644199
• gk580560
• gk522218
• gk871384
• gk925262

1 Chromosome

• WormBase ID: II
• Organism: Caenorhabditis elegans
• Length (nt): 15279421

1 Chromosome Location

• Feature . Primary Identifier: WBGene00013147
• Start: 9826448
• End: 9827952
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrII_9807570..9826447
• Length (nt): 18878
• Chromosome Location: II: 9807570-9826447
• Organism: Caenorhabditis elegans

93 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_NoFood
	Transcripts that showed significantly increased expression in ogt-1(ok1474) neuronal cells isolated by FACs comparing to in FACs isolated neuronal cells from wild type.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066485:ogt-1(ok1474)_upregulated_neuron
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin-Allantoin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Psora-Allantoin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Metformin_upregulated
	Transcripts that showed significantly increased expression in rrf-3(pk1426) comparing to in N2 at embryo stage.	DESeq2v 1.18.1, fold change > 1.5, adjusted p-value < 0.01.	WBPaper00056169:rrf-3(pk1426)_upregulated_embryo
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
Reduced humidity (98% relative humidity).	Genes that were down-regulated after one day exposure to reduced humidity (98% relative humidity) according to microarray analysis.	Multiple hypothesis testing with the Benjamini-Hochberg correction was applied on calculated p-values. A change in the expression level was considered to be significant if the adjusted p-value was less than 0.001.	WBPaper00044578:reduced-humidity_downregulated_microarray
	Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals.	DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2.	WBPaper00062159:hda-2(ok1479)_upregulated
Bacteria infection: Pseudomonas aeruginosa PA14. 4 hours at 25C.	Transcripts that showed significantly decreased expression after N2 L4 animals were infected by P. aeruginosa (PA14) bacteria for 24 hours at 25C.	DESeq R package (1.18.0), FDR < 0.05 and fold change > 2.	WBPaper00062184:PA14_downregulated
	Transcripts that showed significantly increased expression in srbc-48(ac23);kyIs262;fer-1(b232ts) comparing to in kyIs262;fer-1(b232ts), 24h after infection with P.aeruginosa.	DESeq2, FDR <0.05, fold change > 2.	WBPaper00059664:srbc-48(ac23)_upregulated
	Transcripts that showed significantly increased expression in dpy-21(e428) comparing to in N2 during L3 stage.	DESeq v1.6.3. Fold change > 1.5.	WBPaper00050370:dpy-21(e428)_L3_upregulated
	Transcripts that showed significantly increased expression in hda-1(RNAi) embryos comparing to control animals.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00067044:hda-1(RNAi)_upregulated
Starvation	Transcripts that showed significantly altered expression by starvation with 100 mM salt (NaCl)	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:starvation_regulated_LowSalt
	Genes regulated by DAF-12, according to whole transcriptome profiling to compare genome-wide regulatory influences of DPY-21 and SET-4 to those of the key transcription factors controlling dauer arrest in eak-7;akt-1 animals, DAF-16 and DAF-12.	Authors identified genes differentially expressed between wild-type and eak-7;akt-1 double mutant animals [fold change >= 1.5 and false discovery rate (FDR) < 0.05]. Authors then compared the transcriptomes of eak-7;akt-1 double mutants to those of eak-7;akt-1 animals harboring mutations in dpy-21, set-4, daf-16, or daf-12, and identified genes that are differentially expressed in the opposite direction as in wild-type relative to eak-7;akt-1. Annotated gene expression data output from CuffDiff v2.2.1 was read into R version 3.2.1 for six comparisons: eak-7;akt-1 compared to (1) wild-type, (2) daf-16(mu86);eak-7;akt-1, (3) daf-12;eak-7;akt-1, (4) set-4(n4600);eak-7;akt-1, (5) set-4(dp268);eak-7;akt-1, and (6) dpy-21;eak-7;akt-1. Authors filtered genes by the following criteria: (1) status = OK for wild-type vs. eak-7;akt-1, (2) fold change (FC) >= 1.5 or FC <= 1/1.5 for wild-type vs. eak-7;akt-1 and (3) FDR < 0.05 for at least two separate comparisons.	WBPaper00050801:DAF-12_dauer_regulome
	Genes regulated by DAF-16, according to whole transcriptome profiling to compare genome-wide regulatory influences of DPY-21 and SET-4 to those of the key transcription factors controlling dauer arrest in eak-7;akt-1 animals, DAF-16 and DAF-12.	Authors identified genes differentially expressed between wild-type and eak-7;akt-1 double mutant animals [fold change >= 1.5 and false discovery rate (FDR) < 0.05]. Authors then compared the transcriptomes of eak-7;akt-1 double mutants to those of eak-7;akt-1 animals harboring mutations in dpy-21, set-4, daf-16, or daf-12, and identified genes that are differentially expressed in the opposite direction as in wild-type relative to eak-7;akt-1. Annotated gene expression data output from CuffDiff v2.2.1 was read into R version 3.2.1 for six comparisons: eak-7;akt-1 compared to (1) wild-type, (2) daf-16(mu86);eak-7;akt-1, (3) daf-12;eak-7;akt-1, (4) set-4(n4600);eak-7;akt-1, (5) set-4(dp268);eak-7;akt-1, and (6) dpy-21;eak-7;akt-1. Authors filtered genes by the following criteria: (1) status = OK for wild-type vs. eak-7;akt-1, (2) fold change (FC) >= 1.5 or FC <= 1/1.5 for wild-type vs. eak-7;akt-1 and (3) FDR < 0.05 for at least two separate comparisons.	WBPaper00050801:DAF-16_dauer_regulome
	Genes regulated by DPY-21, according to whole transcriptome profiling to compare genome-wide regulatory influences of DPY-21 and SET-4 to those of the key transcription factors controlling dauer arrest in eak-7;akt-1 animals, DAF-16 and DAF-12.	Authors identified genes differentially expressed between wild-type and eak-7;akt-1 double mutant animals [fold change >= 1.5 and false discovery rate (FDR) < 0.05]. Authors then compared the transcriptomes of eak-7;akt-1 double mutants to those of eak-7;akt-1 animals harboring mutations in dpy-21, set-4, daf-16, or daf-12, and identified genes that are differentially expressed in the opposite direction as in wild-type relative to eak-7;akt-1. Annotated gene expression data output from CuffDiff v2.2.1 was read into R version 3.2.1 for six comparisons: eak-7;akt-1 compared to (1) wild-type, (2) daf-16(mu86);eak-7;akt-1, (3) daf-12;eak-7;akt-1, (4) set-4(n4600);eak-7;akt-1, (5) set-4(dp268);eak-7;akt-1, and (6) dpy-21;eak-7;akt-1. Authors filtered genes by the following criteria: (1) status = OK for wild-type vs. eak-7;akt-1, (2) fold change (FC) >= 1.5 or FC <= 1/1.5 for wild-type vs. eak-7;akt-1 and (3) FDR < 0.05 for at least two separate comparisons.	WBPaper00050801:DPY-21_dauer_regulome
Bacteria infection: Serratia marcescens	Genes with increased expression after 24 hours of infection by S.marcescens Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:S.marcescens_24hr_upregulated_TilingArray
	Transcripts down regulated in hpl-2(tm1489) embryo comparing to N2 in tiling array analysis.	Oligos from the tiling array were mapped to chromosome coordinates of the exons from Wormbase WS180. Any oligo that mapped to a gene on both the Watson and Crick strands was excluded. The remaining oligos were then grouped together (perfect match and mismatch) into probe sets and written out into an Affymetrix CDF file. The CDF file was converted into an R-package and loaded into R. The expression values were calculated using the justRMA function from Bioconductor. This used a Benjamini and Hochberg false discovery rate correction.	WBPaper00040560:hpl-2_embryo_downregulated
	Genes expressed in N2.	Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0.	WBPaper00025141:N2_Expressed_Genes
heat-shock hlh-1	Genes enriched in HLH-1 heat shock dataset.	A two-class unpaired analysis was performed to identify genes that are elevated 1.7-fold or greater when compared with the reference for each dataset, at a false discovery rate of 1.8% or less for M0 and 1.2% or less for the M24 datasets.	WBPaper00031003:hlh_1_enriched
	Transcripts that showed significantly increased expression in spr-1(ok2144) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:spr-1(ok2144)_upregulated
	Transcripts that showed significantly increased exression in animals exposed to 100uM cadmium for 24 hours.	DESeq2 v1.20.0, fold change > 2, FDR < 0.05.	WBPaper00065029:cadmium_upregulated
	Genes that showed decreased expression after 1-methylnicotinamide (MNA) treatment.	Raw counts for the genes were analyzed using the R Statistical Computing Environment and the Bioconductor packages DESeq and edgeR. Both packages provide statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting p-values were adjusted using the Benjamini and Hochberg's approach for controlling the false discovery rate (FDR). If both FDR values (by DESeq and edgeR) were smaller than p = 0.05, genes were assigned as differentially expressed.	WBPaper00044260:1-methylnicotinamide_downregulated
	Genes that showed decreased expression after nicotic acid (NA) treatment.	Raw counts for the genes were analyzed using the R Statistical Computing Environment and the Bioconductor packages DESeq and edgeR. Both packages provide statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting p-values were adjusted using the Benjamini and Hochberg's approach for controlling the false discovery rate (FDR). If both FDR values (by DESeq and edgeR) were smaller than p = 0.05, genes were assigned as differentially expressed.	WBPaper00044260:nicotic-acid_downregulated

10 Expression Patterns

• Primary Identifier: Expr7729
• Remark: Clone: pUL#JRH4F5
• Pattern: The early embryo shows GFP expression in two or three cells; this pattern gets more complex during embryogenesis. Late embryos through to the adult show expression in the anterior half of the pharynx with two cell bodies near the tip of the pharynx and processes to the metacorpus of the pharynx.

• Primary Identifier: Expr7035
• Remark: Also expressed in (comments from author) : No comments. Strain: BC10075
• Reporter Gene: [Y53C12C.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAGGCAGTTTGTAATTCTCCACA] 3' and primer B 5' [GTGTCGTGGTAAACCGTGAGT] 3'.
• Pattern: Larval Expression: unidentified cells in head

• Primary Identifier: Expr2011411
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Chronogram717
• Remark: Original chronogram file: chronogram.1748.xml
• Reporter Gene: [Y53C12C.1:gfp] transcriptional fusion.

• Primary Identifier: Expr1160698
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr1170062
• Pattern: Time-lapse fluorescence microscopy was performed, including DIC for morphology. Gene expression patterns were summarized in 4 manners: Average over time, Average over time and at different positions along the anterior-posterior (AP) axis, a voxelized representation over time, and on individual cells overlaid from a reference coordinate dataset (https://doi.org/10.1016/j.ydbio.2009.06.014). The analysis was done with a pipeline based on the multi-purpose image analysis software Endrov (https://doi.org/10.1038/nmeth.2478), which further is needed to browse the raw recording data. Thumbnail movies were also generated, using maximum Z projection for the 3D fluorescence channel. Raw recordings available in the Endrov OST-file format are available at https://www.ebi.ac.uk/biostudies/studies/S-BIAD191?query=S-BIAD191

• Primary Identifier: Expr1024738
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr15621

• Primary Identifier: Expr1170003
• Pattern: Time-lapse fluorescence microscopy was performed, including DIC for morphology. Gene expression patterns were summarized in 4 manners: Average over time, Average over time and at different positions along the anterior-posterior (AP) axis, a voxelized representation over time, and on individual cells overlaid from a reference coordinate dataset (https://doi.org/10.1016/j.ydbio.2009.06.014). The analysis was done with a pipeline based on the multi-purpose image analysis software Endrov (https://doi.org/10.1038/nmeth.2478), which further is needed to browse the raw recording data. Thumbnail movies were also generated, using maximum Z projection for the 3D fluorescence channel. Raw recordings available in the Endrov OST-file format are available at https://www.ebi.ac.uk/biostudies/studies/S-BIAD191?query=S-BIAD191

• Primary Identifier: Expr2029647
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

12 GO Annotation

15 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00013147
• Start: 9826448
• End: 9827952
• Strand: -1

12 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 1505

1 Sequence Ontology Term

• Name: gene

6 Strains

• WBStrain00035387
• WBStrain00036822
• WBStrain00036884
• WBStrain00037126
• WBStrain00049287
• WBStrain00001155

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrII_9827953..9829407
• Length (nt): 1455
• Chromosome Location: II: 9827953-9829407
• Organism: Caenorhabditis elegans