WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00012316 Gene Name  ctps-1
Sequence Name  ? W06H3.3 Organism  Caenorhabditis elegans
Automated Description  Predicted to enable ATP binding activity and CTP synthase activity. Predicted to be involved in 'de novo' CTP biosynthetic process and glutamine metabolic process. Expressed in germ line. Human ortholog(s) of this gene implicated in biliary tract benign neoplasm; colorectal cancer; and immunodeficiency 24. Is an ortholog of human CTPS1 (CTP synthase 1) and CTPS2 (CTP synthase 2). Biotype  SO:0001217
Genetic Position  V :11.1834± Length (nt)  ? 7851
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00012316

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:W06H3.3b.1 W06H3.3b.1 2073   V: 16794908-16801812
Transcript:W06H3.3a.1 W06H3.3a.1 2966   V: 16795332-16802758
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:W06H3.3b W06H3.3b 2073   V: 16794908-16794959
CDS:W06H3.3a W06H3.3a 2019   V: 16795333-16795449

16 RNAi Result

WormBase ID
WBRNAi00094366
WBRNAi00009261
WBRNAi00026505
WBRNAi00085841
WBRNAi00019679
WBRNAi00094185
WBRNAi00094283
WBRNAi00033280
WBRNAi00082479
WBRNAi00082656
WBRNAi00071603
WBRNAi00054916
WBRNAi00062404
WBRNAi00094482
WBRNAi00094513
WBRNAi00075895

174 Allele

Public Name
gk963271
gk963489
gk963304
WBVar02123303
WBVar02124908
gk964050
WBVar02123708
gk963587
gk963588
WBVar02124497
WBVar02124626
WBVar02124059
WBVar02122686
WBVar02124833
WBVar00248216
WBVar00246655
WBVar01976634
WBVar01976632
WBVar01976639
WBVar01976637
WBVar01976638
WBVar01976635
WBVar01652369
WBVar01652368
WBVar01652370
gk949506
cxTi10465
WBVar01593972
WBVar01593971
WBVar02121795

1 Chromosome

WormBase ID Organism Length (nt)
V Caenorhabditis elegans 20924180  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00012316 16794908 16802758 1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrV_16802759..16802871   113 V: 16802759-16802871 Caenorhabditis elegans

109 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  oocyte proteins identified by two or more unique peptides during proteomics study. In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide. WBPaper00038289:oocyte_protein
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
  Transcripts that showed significantly decreased expression in AGP22 [nhr-49(nr2041)I;glp-1(e2141)III] comparing to in CF1903 [glp-1(e2144)III] at Day 2 adults. Fold change > 2, p Value of < 0.05 and a false discovery rate (FDR) of < 0.05. WBPaper00061530:nhr-49(e2144)_downregulated
  mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis. Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05. WBPaper00045420:fertilization_downregulated_transcript
  Proteins interacting with NHR-49-GFP according to co-IP and LC-MS. N.A. WBPaper00064071:NHR-49_interacting
  Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:intestine_expressed
  Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
  Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
  Transcripts detected in germline isolated from day-1 adult hermaphrodite animals. All three experiments have CPM >= 1. WBPaper00067147:germline_expressed
  Significantly differentially expressed genes as determined by microarray analysis of wild-type and cde-1 mutant germlines. RNAs that changed at least 2-fold with a probability of p < 0.05 were considered differentially regulated between wildtype and cde-1. WBPaper00035269:cde-1_regulated
  Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage. DESeq WBPaper00053302:stavudine_24h_regulated
  Transcripts that showed significantly increased expression in oocyte germline cells comparing to in mitosis germline cells. Log2 Fold change > 2 or <-1, p-value < 0.05. WBPaper00053599:oocyte_vs_mitosis_upregulated
  Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy. Cufflinks WBPaper00065120:body-muscle-transcriptome
Bacteria infection: Pseudomonas aeruginosa PA14. 24 hours of exposure at 25C. Transcripts that showed significantly increased expression in N2 animals with 24 hours of exposure to P. aeruginosa PA14 for 24 hrs at 25C, comparing to N2 animals without exposure to PA14. DESeq2, fold change > 2, FDR < 0.05. WBPaper00058948:PA14_upregulated
Temprature shift to 28C for 24 hours. Transcripts that showed significantly decreased expression after animals were exposed to 28C temperature for 24 hours. Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control. WBPaper00061341:28C_24h_downregulated
Temprature shift to 28C for 48 hours. Transcripts that showed significantly decreased expression after animals were exposed to 28C temperature for 48 hours. Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control. WBPaper00061341:28C_48h_downregulated
  Proteins that showed significantly decreased expression after 1-day-old wild type adults were exposed to cisplatin (300ug per mL) for 6 hours. The differential expression analysis was performed in R. Differentially expressed proteins were identified by using a two-sided t-test on log-transformed data. WBPaper00065373:Cisplatin_downregulated_WT
  Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:dopaminergic-neurons_L3-L4-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:intestine_L2-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:PVD-OLL-neurons_L3-L4-larva_expressed
  Transcripts that showed significantly decreased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Psora-Allantoin_downregulated
  Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rapamycin-Metformin_downregulated
  Transcripts that showed significantly decreased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rifampicin-Allantoin_downregulated
  Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage. DESeq2, fold change > 2, FDR < 0.05. WBPaper00066594:ilc-17.1(syb5296)_upregulated
  Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis. To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq. WBPaper00045521:Gender_Neutral
Starvation Transcripts that showed significantly altered expression by starvation with 100 mM salt (NaCl) DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:starvation_regulated_LowSalt
  Proteins identified in extracellular vesicle. N.A. WBPaper00062669:extracellular-vesicle_protein
  Genes regulated by DAF-16, according to whole transcriptome profiling to compare genome-wide regulatory influences of DPY-21 and SET-4 to those of the key transcription factors controlling dauer arrest in eak-7;akt-1 animals, DAF-16 and DAF-12. Authors identified genes differentially expressed between wild-type and eak-7;akt-1 double mutant animals [fold change >= 1.5 and false discovery rate (FDR) < 0.05]. Authors then compared the transcriptomes of eak-7;akt-1 double mutants to those of eak-7;akt-1 animals harboring mutations in dpy-21, set-4, daf-16, or daf-12, and identified genes that are differentially expressed in the opposite direction as in wild-type relative to eak-7;akt-1. Annotated gene expression data output from CuffDiff v2.2.1 was read into R version 3.2.1 for six comparisons: eak-7;akt-1 compared to (1) wild-type, (2) daf-16(mu86);eak-7;akt-1, (3) daf-12;eak-7;akt-1, (4) set-4(n4600);eak-7;akt-1, (5) set-4(dp268);eak-7;akt-1, and (6) dpy-21;eak-7;akt-1. Authors filtered genes by the following criteria: (1) status = OK for wild-type vs. eak-7;akt-1, (2) fold change (FC) >= 1.5 or FC <= 1/1.5 for wild-type vs. eak-7;akt-1 and (3) FDR < 0.05 for at least two separate comparisons. WBPaper00050801:DAF-16_dauer_regulome
  Genes regulated by DPY-21, according to whole transcriptome profiling to compare genome-wide regulatory influences of DPY-21 and SET-4 to those of the key transcription factors controlling dauer arrest in eak-7;akt-1 animals, DAF-16 and DAF-12. Authors identified genes differentially expressed between wild-type and eak-7;akt-1 double mutant animals [fold change >= 1.5 and false discovery rate (FDR) < 0.05]. Authors then compared the transcriptomes of eak-7;akt-1 double mutants to those of eak-7;akt-1 animals harboring mutations in dpy-21, set-4, daf-16, or daf-12, and identified genes that are differentially expressed in the opposite direction as in wild-type relative to eak-7;akt-1. Annotated gene expression data output from CuffDiff v2.2.1 was read into R version 3.2.1 for six comparisons: eak-7;akt-1 compared to (1) wild-type, (2) daf-16(mu86);eak-7;akt-1, (3) daf-12;eak-7;akt-1, (4) set-4(n4600);eak-7;akt-1, (5) set-4(dp268);eak-7;akt-1, and (6) dpy-21;eak-7;akt-1. Authors filtered genes by the following criteria: (1) status = OK for wild-type vs. eak-7;akt-1, (2) fold change (FC) >= 1.5 or FC <= 1/1.5 for wild-type vs. eak-7;akt-1 and (3) FDR < 0.05 for at least two separate comparisons. WBPaper00050801:DPY-21_dauer_regulome
  Transcripts that showed significantly decreased expression in nhl-2(ok818) comparing to in N2 at 25C. EdgeR, FDR < 0.05, fold change < 0.5. WBPaper00055971:nhl-2(ok818)_25C_upregulated

8 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Strain: BC13653 [W06H3.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAAAAACAACAAATTTTACAGCAG] 3' and primer B 5' [GCCCGGGATCTCTGTAATAGAC] 3'. Expr6844 Adult Expression: intestine; Larval Expression: intestine;  
    Expr14957 Whole-worm immunostaining demonstrated that CTPS-1 is expressed predominantly in the intestine and germline.  
    Expr1012763 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr1158458 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr2010579 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr2028819 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1035449 Tiling arrays expression graphs  
Original chronogram file: chronogram.1319.xml [W06H3.3:gfp] transcriptional fusion. Chronogram297    

11 GO Annotation

Annotation Extension Qualifier
  involved_in
  involved_in
  enables
  enables
  enables
  enables
  enables
  enables
  enables
  involved_in
  involved_in

11 Homologues

Type
orthologue
orthologue
orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue
orthologue
least diverged orthologue
least diverged orthologue
orthologue
least diverged orthologue

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00012316 16794908 16802758 1

11 Ontology Annotations

Annotation Extension Qualifier
  involved_in
  involved_in
  enables
  enables
  enables
  enables
  enables
  enables
  enables
  involved_in
  involved_in

0 Regulates Expr Cluster

1 Sequence

Length
7851

1 Sequence Ontology Term

Identifier Name Description
gene  

1 Strains

WormBase ID
WBStrain00002678

0 Upstream Intergenic Region