WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00012318 Gene Name  srxa-1
Sequence Name  ? W07A8.1 Organism  Caenorhabditis elegans
Automated Description  Predicted to be located in membrane. Expressed in ADFL; ADFR; AWBL; and AWBR. Biotype  SO:0001217
Genetic Position  V :25.0365 ±0.000595 Length (nt)  ? 1155
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00012318

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:W07A8.1.1 W07A8.1.1 998   V: 20732087-20733241
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:W07A8.1 W07A8.1 963   V: 20732087-20732333

6 RNAi Result

WormBase ID
WBRNAi00002322
WBRNAi00054929
WBRNAi00054930
WBRNAi00004979
WBRNAi00019688
WBRNAi00036355

27 Allele

Public Name
gk963271
gk964176
gk962705
gk963489
gk963304
gk963809
WBVar01756670
WBVar01756671
WBVar00073837
WBVar00073836
WBVar00073835
WBVar01467091
gk267794
gk267793
gk267795
gk720945
gk898059
gk793627
gk836047
gk737412
gk399921
gk558490
gk378887
gk568007
gk919386
gk560865
WBVar00229301

1 Chromosome

WormBase ID Organism Length (nt)
V Caenorhabditis elegans 20924180  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00012318 20732087 20733241 1

3 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  

0 Downstream Intergenic Region

18 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in ogt-1(ok1474) neuronal cells isolated by FACs comparing to in FACs isolated neuronal cells from wild type. DESeq2, fold change > 2, FDR < 0.05. WBPaper00066485:ogt-1(ok1474)_upregulated_neuron
  mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis. Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05. WBPaper00045420:fertilization_downregulated_transcript
  TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood. SAM WBPaper00031040:TGF-beta_adult_upregulated
  Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology. DESEQ2, fold change > 2 and FDR < 0.01. WBPaper00062103:neuron_enriched
  Transcripts that showed significantly decreased expression in eat-2(ad1116) comparing to in N2 at 3-days post L4 adult hermaphrodite animals. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:eat-2(ad1116)_downregulated
  Transcripts that showed significantly decreased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rifampicin-Allantoin_downregulated
  Significantly upregulated genes from cyc-1(RNAi) microarrays using SAM algorithm with an FDR < 0.1 from adult-only chips. SAM algorithm with an FDR < 0.1. WBPaper00033065:cyc-1(RNAi)_upregulated
  Genes that showed significant differential expressed between control and 150 mg\/L Atrazine treatment. t-test, p < 0.05. WBPaper00036123:Atrazine_regulated
Temperature Shift: 25C vs 15C for 16 hours at L4 larva stage. Transcripts that showed significantly increased expression in AFD neurons comparing to in whole animals. DESeq2, fold change > 2, FDR < 0.05. WBPaper00065158:AFD_enriched
moderate static magnetic field Transcripts that showed significantly decreased expression after exposure to moderate static magnetic field. N.A. WBPaper00064509:static-magnetic-field_downregulated
Fungi infection: Drechmeria coniospora Genes with decreased expression after 12 hours of infection by D.coniospora Fold changes shown are pathogen vs OP50. For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. WBPaper00038438:D.coniospora_12hr_downregulated_RNAseq
  Genome-wide analysis of developmental and sex-regulated gene expression profile. self-organizing map cgc4489_group_9
Diet: supplemented with milk fat-containing protein powder from L1 to day 2 adult stage. Transcripts that showed significantly decreased expression in N2 animals fed with OP50 supplemented with milk fat-containing protein powder from L1 to day 2 adult stage. Differential expression analysis between two conditions (three biological replicates per condition) was performed using DESeq2. Genes with p-value < 0.05 and Fold Change > 2 found by DESeq2 were assigned as differentially expressed. WBPaper00067530:Milk-protein_downregulated
  Coexpression clique No. 211, srj-42-srw-113, on the genome-wide coexpression clique map for the nematode GPL200 platform. All available microarray datasets for the GPL200 platform (Affymetrix C. elegans Genome Array) were obtained from the GEO repository. This included 2243 individual microarray experiments. These were normalized against each other with the software RMAexpress (Bolstad, 2014). Based on these normalized values, Pearsons correlation coefficients were obtained for each probe-probe pair of the 22,620 probes represented on this array type. The resulting list of correlation coefficients was then ranked to generate the ranked coexpression database with information on each probe represented on the GPL200 platform. WBPaper00061527:srj-42-srw-113
  Transcripts that showed significantly increased expression in drh-3(rrr2) comparing to in N2. edgeR, log2 fold change > 2 or < -2. WBPaper00053888:drh-3(rrr2)_upregulated
  Transcripts that showed significantly increased expression in spr-5(by101);met-2(n4256) L1 animals comparing to in N2 control. DeSeq2 (v.2.11.40.2), p < 0.05. WBPaper00060886:spr-5(by101);met-2(n4256)_upregulated
  Transcripts that showed significantly increased expression after exposure to 0.1ug/L MWCNT from L1 to day 1 adult stage in liquid solutions with OP50. Fold change > 2. WBPaper00057254:MWCNT_upregulated_mRNA
  Top 300 transcripts enriched in DA1, DA2, DA3, DA4, DA5, DA6, DA7, DA8, DA9, DB1, DB2, DB3, DB4, DB5, DB6, DB7 according to single cell RNAseq. Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm. WBPaper00061340:DA_DB

7 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr2035037 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
Strain: BC14896 [srxa-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCCATAATGTGCCTATCAAATGT] 3' and primer B 5' [AGGATGATGATAAGACGGGAAAT] 3'. Expr6847 Adult Expression: Nervous System; head neurons; Larval Expression: hypodermis; Nervous System; head neurons;  
    Expr14189 AWB, ADF  
    Expr1035451 Tiling arrays expression graphs  
    Expr1158470 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr1026557 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr2016871 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  

1 GO Annotation

Annotation Extension Qualifier
  located_in

0 Homologues

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00012318 20732087 20733241 1

1 Ontology Annotations

Annotation Extension Qualifier
  located_in

0 Regulates Expr Cluster

1 Sequence

Length
1155

1 Sequence Ontology Term

Identifier Name Description
gene  

1 Strains

WormBase ID
WBStrain00062324

0 Upstream Intergenic Region