WormMine: Gene WBGene00015326

• WormBase Gene ID: WBGene00015326
• Gene Name: ivd-1
• Sequence Name: C02B10.1
• Brief Description: ivd-1 encodes an isovaleryl-CoA dehydrogenase; this function has been verified by both sequence homology and direct biochemical assay.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable isovaleryl-CoA dehydrogenase activity. Involved in regulation of response to oxidative stress. Predicted to be located in mitochondrion. Expressed in head. Human ortholog(s) of this gene implicated in isovaleric acidemia. Is an ortholog of human IVD (isovaleryl-CoA dehydrogenase).
• Biotype: SO:0001217
• Genetic Position: IV :1.43936 ±0.002365
• Length (nt): 2009

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00015326

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:C02B10.1.1	C02B10.1.1	1458	IV: 5086856-5088864

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:C02B10.1	C02B10.1	1260	IV: 5087024-5087338

4 RNAi Result

• WBRNAi00039385
• WBRNAi00009964
• WBRNAi00108514
• WBRNAi00102599

29 Allele

• gk964500
• gk963722
• gk963867
• gk963150
• h14927
• gk201371
• gk201372
• gk201373
• gk201374
• gk201375
• tm6784
• gk342263
• gk351123
• gk796063
• gk932599
• gk715901
• gk545364
• WBVar01898949
• hh6
• gk763259
• gk719109
• gk835125
• gk367572
• gk882950
• WBVar01923309
• gk387463
• gk573917
• gk676548
• tm12481

1 Chromosome

• WormBase ID: IV
• Organism: Caenorhabditis elegans
• Length (nt): 17493829

1 Chromosome Location

• Feature . Primary Identifier: WBGene00015326
• Start: 5086856
• End: 5088864
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

152 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	oocyte proteins identified by two or more unique peptides during proteomics study.	In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide.	WBPaper00038289:oocyte_protein
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
	Transcripts that showed significantly increased expression in day 3 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_upregulated_fem-3(q20)
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure.	Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2).	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:S.aureus-4h_upregulated_N2
	Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_SM
	Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals.	Sleuth	WBPaper00051558:aging_regulated
	Transcripts that showed significantly increased expression in sftb-1(cer6) deletion homozygous comparing to to in N2 animals at L4 larva stage.	DESeq2, fold change > 2	WBPaper00058725:sftb-1(cer6)_downregulated
Bacteria infection: Pseudomonas aeruginosa PA14. 24 hours of exposure at 25C.	Transcripts that showed significantly increased expression in N2 animals with 24 hours of exposure to P. aeruginosa PA14 for 24 hrs at 25C, comparing to N2 animals without exposure to PA14.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00058948:PA14_upregulated
Temprature shift to 28C for 24 hours.	Transcripts that showed significantly decreased expression after animals were exposed to 28C temperature for 24 hours.	Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control.	WBPaper00061341:28C_24h_downregulated
Temprature shift to 28C for 48 hours.	Transcripts that showed significantly decreased expression after animals were exposed to 28C temperature for 48 hours.	Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control.	WBPaper00061341:28C_48h_downregulated
Growth temperature	Transcripts that are significantly downregulated at 15C compared to both 25C and 20C, with no statistical difference between 25C and 20C, in worms feeding B. subtilis PY79.	DESeq2 and EdgeR, adjusted p-value < 0.05.	WBPaper00053814:15C_downregulated_PY79
Bacteria infection: Streptococcus gordonii	Transcripts that showed significantly decreased expression after L4 larva animals were exposed to wild type S. gordonii for 2-3 hours, comparing to animals exposed to S. gordonii delta-spxB.	Fold change > 2, FDR corrected p-value < 0.05.	WBPaper00055049:S.gordonii_downregulated
	Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066594:ilc-17.1(syb5296)_upregulated
	Transcripts that showed significantly decreased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin_downregulated
Skin Wounding: skin wounding using femtosecond or Micropoint UV laser or with single stabs of a microinjection needle to the anterior or posterior body 24 h after the L4 stage.	Transcripts that showed significantly decreased expression after skin wounding using femtosecond or Micropoint UV laser or with single stabs of a microinjection needle to the anterior or posterior body 24 h after the L4 stage of N2 animals.	The cutoff for differential expressed genes (DEGs) were: Benjamini-Hochberg adjusted p-value less than 0.05 and fold change larger than 1.5.	WBPaper00059895:wounding_downregulated
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
	Proteins interacting with HA-PPM-1.D.	N.A.	WBPaper00062498:PPM-1.D_interacting

7 Expression Patterns

• Primary Identifier: Expr5102
• Remark: Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC11078
• Reporter Gene: [C02B10.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACCATCCGCTTCTAGTCATTGT] 3' and primer B 5' [GAGATTTTCACCAAGAAGTCGG] 3'.
• Pattern: Adult Expression: pharynx; Reproductive System; vulval muscle; spermatheca; unidentified cells in head; Larval Expression: pharynx; unidentified cells in head

• Primary Identifier: Expr1036563
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr1015733
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2031112
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1143502
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2012878
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Chronogram1081
• Remark: Original chronogram file: chronogram.2146.xml
• Reporter Gene: [C02B10.1:gfp] transcriptional fusion.

10 GO Annotation

5 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00015326
• Start: 5086856
• End: 5088864
• Strand: -1

10 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 2009

1 Sequence Ontology Term

• Name: gene

1 Strains

• WBStrain00001621

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrIV_5088865..5090242
• Length (nt): 1378
• Chromosome Location: IV: 5088865-5090242
• Organism: Caenorhabditis elegans