WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00015746 Gene Name  C13F10.7
Sequence Name  ? C13F10.7 Organism  Caenorhabditis elegans
Automated Description  Enables identical protein binding activity. Is an ortholog of human SREK1IP1 (SREK1 interacting protein 1). Biotype  SO:0001217
Genetic Position  Length (nt)  ? 1199
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00015746

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:C13F10.7.1 C13F10.7.1 951   V: 7222054-7223252
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:C13F10.7 C13F10.7 669   V: 7222336-7222817

6 RNAi Result

WormBase ID
WBRNAi00040452
WBRNAi00010695
WBRNAi00010697
WBRNAi00028850
WBRNAi00007919
WBRNAi00111885

28 Allele

Public Name
gk963301
gk963553
gk964259
gk964351
gk963850
gk962860
WBVar00243233
WBVar01974046
gk238900
gk238901
WBVar02023918
WBVar00211202
WBVar00211201
gk564199
gk744912
gk901310
gk824432
gk765471
gk803273
gk727502
gk372553
gk819596
gk837134
gk443025
gk743007
WBVar01786610
gk5486
WBVar01741102

1 Chromosome

WormBase ID Organism Length (nt)
V Caenorhabditis elegans 20924180  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00015746 7222054 7223252 -1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

0 Downstream Intergenic Region

149 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:AVE-neuron_L1-larva_expressed
  Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc). DESeq2, fold change >= 2, FDR <= 0.01. WBPaper00056826:SGP_biased
Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours. Transcripts that showed significantly decreased expression in N2 after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50. Cuffcompare and Cuffdiff WBPaper00056090:E.faecalis_downregulated_N2
  Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:body-muscle_expressed
  Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:GABAergic-neuron_expressed
  Genes that are significantly up regulated in tdp-1(ok803) poly(A) RNA-seq verses in N2. DESeq v1.14, with cut-off p-value < 0.05 and FDR < 0.1. WBPaper00046012:tdp-1(ok803)_upregulated
  Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:hypodermis_expressed
  Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:intestine_expressed
  Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:NMDA-neuron_expressed
  Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:pharynx_expressed
  Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade). For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). WBPaper00040858:eQTL_age_regulated_developing
  Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:seam_expressed
  Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-1-adult_vs_L4_upregulated_fem-3(q20)
  Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
  Genes with expression level regulated by genotype (N2 vs CB4856) at Late reproduction stage (96 hours at 24 centigrade). Authors permuted transcript values and used a genome-wide threshold of log10 P-value = 2, which resembles a false discovery rate (FDR) of 0.0118. WBPaper00040858:eQTL_regulated_reproductive
Bacteria diet: Escherichia coli HB101. Fed for 30 generations. Transcripts that showed significantly decreased expression after fed by bacteria E. coli HB101 for 30 generations comparing to animals fed by E. coli OP50. DESeq2 fold change > 2, p-value < 0.01. WBPaper00061007:HB101_downregulated
Bacteria diet: Sphingomonas aquatilis Yellow. Fed for 30 generations. Transcripts that showed significantly decreased expression after fed by bacteria Sphingomonas aquatilis (Yellow) for 30 generations comparing to animals fed by E. coli OP50. DESeq2 fold change > 2, p-value < 0.01. WBPaper00061007:S.aquatilis_downregulated
  Maternal class (M): genes that are called present in at least one of the three PC6 replicates. A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. [cgc5767]:expression_class_M
  Transcripts that showed significantly increased expression in alg-1(gk214), comparing to in N2. DESeq2, Fold change > 1.5. WBPaper00051404:alg-1(gk214)_upregulated
  Genes down regulated by mir-243(n4759). RNAs that changed at least 2-fold with a probability of p > 0.05 in three biological replicates were considered differentially regulated between wild-type and mir-243. WBPaper00036130:mir-243_down_regulated
25C vs. 20C Transcripts that showed significantly increased expression in 1-day post L4 adult hermaphrodite N2 grown at 25C, comparing to in N2 animals grown at 20C. CuffDiff, fold change > 2. WBPaper00065096:25C_vs_20C_upregulated
  Transcripts that showed significantly increased expression in 10-days post L4 adult hermaphrodite N2 grown at 20C, comparing to in 1-day post L4 adult hermaphrodite N2 animals grown at 20C. CuffDiff, fold change > 2. WBPaper00065096:Day10_vs_Day1_upregulated
  Genes with increased RNA expression after 24 hours rotenone treatment EdgeR provides statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting p-values were adjusted using the Benjamini and Hochbergs approach for controlling the false discovery rate (FDR). Transcripts with an adjusted p-value smaller 0.05 were assigned as differentially expressed. WBPaper00044426:rotenone_24h_upregulated
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:A-class-motor-neurons_L2-larva_expressed
  Transcripts that showed significantly decreased expression in tetraploid N2 comparing to diploid N2 animals at L4 larva stage. DESeq2 R package (1.20.0), fold change > 2, and FDR < 0.05. WBPaper00066110:tetraploid_vs_diploid_downregulated
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:all-neurons_L2-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:coelomocytes_L2-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:dopaminergic-neurons_L3-L4-larva_expressed

7 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Also expressed in (comments from author) : No comments. Strain: BC15499 [C13F10.7::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATGTCCATTCCCTTGATAACTTGT] 3' and primer B 5' [TCGCGATCTGTAATTGTAGTGAAT] 3'. Expr5259 Adult Expression: pharynx; intestine; anal depressor muscle; rectal epithelium; Reproductive System; vulval muscle; spermatheca; hypodermis; seam cells; Nervous System; head neurons; Larval Expression: pharynx; intestine; anal depressor muscle; rectal epithelium; Reproductive System; developing vulva; developing spermatheca; hypodermis; seam cells; Nervous System; head neurons;  
    Expr1036738 Tiling arrays expression graphs  
Original chronogram file: chronogram.1536.xml [C13F10.7:gfp] transcriptional fusion. Chronogram520    
    Expr1144518 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr1015493 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr2018969 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr2000750 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  

4 GO Annotation

Annotation Extension Qualifier
  enables
  enables
  enables
  enables

5 Homologues

Type
least diverged orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00015746 7222054 7223252 -1

4 Ontology Annotations

Annotation Extension Qualifier
  enables
  enables
  enables
  enables

0 Regulates Expr Cluster

1 Sequence

Length
1199

1 Sequence Ontology Term

Identifier Name Description
gene  

1 Strains

WormBase ID
WBStrain00003516

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrV_7223253..7224077   825 V: 7223253-7224077 Caenorhabditis elegans