WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00016091 Gene Name  nhr-30
Sequence Name  ? C25E10.1 Organism  Caenorhabditis elegans
Automated Description  Predicted to enable DNA-binding transcription factor activity; sequence-specific DNA binding activity; and zinc ion binding activity. Predicted to be involved in regulation of DNA-templated transcription. Predicted to be located in nucleus. Expressed in head. Biotype  SO:0001217
Genetic Position  V :1.91391 ±0.000443 Length (nt)  ? 1795
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00016091

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:C25E10.1.1 C25E10.1.1 1340   V: 9045171-9046965
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:C25E10.1 C25E10.1 1251   V: 9045182-9045318

2 RNAi Result

WormBase ID
WBRNAi00041179
WBRNAi00011158

29 Allele

Public Name
gk963301
gk964351
gk962860
gk964052
gk963442
gk963441
gk963163
tm811
gk242509
WBVar00213526
WBVar01742496
gk478133
gk920419
gk904620
gk849564
gk511931
gk388790
gk546210
gk572200
gk710650
gk594001
gk415756
gk786807
gk617934
gk821837
gk937527
WBVar01461078
gk789741
gk486422

1 Chromosome

WormBase ID Organism Length (nt)
V Caenorhabditis elegans 20924180  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00016091 9045171 9046965 1

3 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  

0 Downstream Intergenic Region

54 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells. DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction. WBPaper00060811:L1_vs_adult_upregulated_neural
  Transcripts of coding genes that showed significantly decreased expression in muscle. DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. WBPaper00062325:muscle_depleted_coding-RNA
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology. DESEQ2, fold change > 2 and FDR < 0.01. WBPaper00062103:neuron_enriched
  Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2. DESeq2, fold change > 2, p-value < 0.01. WBPaper00061203:sin-3(tm1276)_upregulated
  Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult. DESeq2, fold change > 2, adjusted p-value < 0.01 WBPaper00058598:sin-3(tm1276)_downregulated
  Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals. DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2. WBPaper00062159:hda-2(ok1479)_upregulated
  Transcripts that showed significantly increased expression in dpy-21(e428) comparing to in N2 during L3 stage. DESeq v1.6.3. Fold change > 1.5. WBPaper00050370:dpy-21(e428)_L3_upregulated
  Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 50uM Rifampicin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rapamycin-Rifampicin_downregulated
  Transcripts that showed significantly decreased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rifampicin-Allantoin_downregulated
  Transcripts that showed significantly increased expression in spr-1(ok2144) comparing to in N2. DESeq2, fold change > 2, p-value < 0.01. WBPaper00061203:spr-1(ok2144)_upregulated
  Transcripts that showed significantly decreased expression in whole animal day 1 N2 adults comparing to in whole animal day 8 N2 adults. DESeq2, FDR < 0.05, fold change > 2. WBPaper00066978:Day1Adult_vs_Day8Adult_downregulated_neuron
  Transcripts that showed differential expression in dauer mir-34(gk437) vs dauer mir-34(OverExpression) animals at 20C. N.A. WBPaper00050488:mir-34(gk437)_vs_mir-34(OverExpression)_regulated_dauer_20C
  Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin, 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rapamycin-Rifampicin-Allantoin_downregulated
  Transcripts that showed significantly decreased expression after animals were treated with 50uM Rifampicin and 100uM Psora from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rifampicin-Psora_downregulated
moderate static magnetic field Transcripts that showed significantly decreased expression after exposure to moderate static magnetic field. N.A. WBPaper00064509:static-magnetic-field_downregulated
  Transcripts that showed significantly increased expression in diploid N2 animals after exposure to 5 uM doxorubicin for 72 hours at 15C from L1 to L4 larve stage. DESeq2 R package (1.20.0), fold change > 2, and FDR < 0.05. WBPaper00066110:Doxorubicin_upregulated_diploid
Fungi infection: Drechmeria coniospora Genes with decreased expression after 12 hours of infection by D.coniospora Fold changes shown are pathogen vs OP50. For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. WBPaper00038438:D.coniospora_12hr_downregulated_RNAseq
  Transcripts that showed significantly decreased expression in unc-70(cas983) comparing to in N2 at L1 larva stage. DESeq2, fold change >= 2, FDR <= 0.05 WBPaper00057041:unc-70(cas983)_downregulated
  Transcripts that showed significantly increased expression in mex-1(or286) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult. RPKM fold change > 2. WBPaper00058598:mex-1(or286)_upregulated
  Transcripts that showed significantly increased expression in mex-3(eu149) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult. RPKM fold change > 2. WBPaper00058598:mex-3(eu149)_upregulated
  Transcripts that showed significantly increased expression in spn-4(tm291) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult. RPKM fold change > 2. WBPaper00058598:spn-4(tm291)_upregulated
  Genes that showed significantly decreased expression after exposure to 1mg/L MWCNTs from L1 larva to young adult. Transcripts with false discovery rate-corrected p-values < 0.05 and fold change > 2 were defined as differentially expressed. WBPaper00049377:MWCNT_downregulated
  Genome-wide analysis of developmental and sex-regulated gene expression profile. self-organizing map cgc4489_group_9
  Transcripts that showed significantly increased expression in AGP22 [nhr-49(nr2041)I;glp-1(e2141)III] comparing to in CF1903 [glp-1(e2144)III] at Day 2 adults. Fold change > 2, p Value of < 0.05 and a false discovery rate (FDR) of < 0.05. WBPaper00061530:nhr-49(e2144)_upregulated
  Genes up-regulated after 24 hour exposure to colistin. Gene lists were created using a cutoff P-value of < 0.05, 2-fold change. WBPaper00045673:colistin_upregulated
  Transcripts that showed significantly increased expression in alg-1(gk204) comparing to in N2 at 5-days post L4 adult hermaphrodites. DESeq, fold change > 2, adjusted p-value < 0.05. WBPaper00054758:alg-1(gk204)_upregulated
  Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin, 50uM Rifampicin and 100uM Psora from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rapamycin-Rifampicin-Psora_downregulated
  Genes that showed significantly decreased expression level in rsr-2(RNAi) animals comparing to in gfp(RNAi) control. Fold change > 1.2 or < 0.8. WBPaper00042477:rsr-2(RNAi)_downregulated_TilingArray

7 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Also expressed in (comments from author) : Unidentified cells, possibly amphids. Strain: BC11669 [C25E10.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCCTTCTACGTAGTGTTCATTGG] 3' and primer B 5' [CATGGATATCGGAAGTTGAATGT] 3'. Expr5335 Adult Expression: intestine; Nervous System; head neurons; unidentified cells in head; Larval Expression: intestine; Nervous System; head neurons; unidentified cells in head;  
    Expr1200327 Data from the TransgeneOme project  
    Expr1024504 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Original chronogram file: chronogram.685.xml [C25E10.1:gfp] transcriptional fusion. Chronogram1770    
    Expr2014179 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr2032420 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1145210 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  

7 GO Annotation

Annotation Extension Qualifier
  located_in
  involved_in
  enables
  enables
  enables
  enables
  enables

0 Homologues

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00016091 9045171 9046965 1

7 Ontology Annotations

Annotation Extension Qualifier
  located_in
  involved_in
  enables
  enables
  enables
  enables
  enables

0 Regulates Expr Cluster

1 Sequence

Length
1795

1 Sequence Ontology Term

Identifier Name Description
gene  

1 Strains

WormBase ID
WBStrain00001843

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrV_9043678..9045170   1493 V: 9043678-9045170 Caenorhabditis elegans