WormMine: Gene WBGene00016539

• WormBase Gene ID: WBGene00016539
• Gene Name: madd-2
• Sequence Name: C39F7.2
• Brief Description: madd-2 encodes a protein containing RBCC/TRIM, fibronectin type III, and SPRY domains that is the sole C. elegans member of the C1 subfamily of tripartite motif (TRIM) proteins and is homologous to mammalian TRIM9, TRIM67, and MID1/TRIM18, mutations in which result in Opitz G/BBB syndrome, a congenital malformation disorder affecting ventral midline structures and resulting in mental retardation; in C. elegans, MADD-2 functions cell autonomously as a specificity factor in an UNC-6/Netrin, and UNC-40/DCC-mediated pathway that regulates axon branch formation and attractive axon guidance in multiple neuronal types by potentiating UNC-40 activity; in addition, MADD-2 is required for ventral recruitment of MIG-10/Lamellopodin in the HSNs during outgrowth; MADD-2 also functions cell autonomously in body wall muscle in an UNC-40/DCC and UNC-73/Rho-GEF-mediated pathway to regulate muscle arm extension to ventral midline motor axons; MADD-2 exhibits E3 ubiquitin ligase activity in vitro, physically interacts with both UNC-40 and UNC-73, and may potentiate the in vivo interaction between UNC-40 and UNC-73; a MADD-2::GFP fusion protein is expressed in neurons, hypodermis, and muscle cells; expression is also seen in the anchor cell, the ventral uterine precursor cells and in the ray precursors and descendants in males; in neurons, MADD-2 colocalizes with UNC-40 to the ventral axon branches that require its function; in body wall muscle, MADD-2 localizes to the dense bodies and colocalizes to the muscle arm termini with UNC-40 and UNC-73.
• Organism: Caenorhabditis elegans
• Automated Description: Enables protein homodimerization activity; signaling receptor binding activity; and ubiquitin-protein transferase activity. Involved in cell projection organization; protein ubiquitination; and regulation of protein localization. Located in several cellular components, including cell leading edge; neuronal cell body; and striated muscle dense body. Expressed in several structures, including anchor cell; intestinal cell; muscle cell; neurons; and ray precursor cell. Used to study Opitz GBBB syndrome. Human ortholog(s) of this gene implicated in Opitz GBBB syndrome; anencephaly; and non-syndromic X-linked intellectual disability 101. Is an ortholog of human TRIM67 (tripartite motif containing 67) and TRIM9 (tripartite motif containing 9).
• Biotype: SO:0001217
• Genetic Position: V :-19.8476 ±0.000552
• Length (nt): 11559

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00016539

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:C39F7.2b.1	C39F7.2b.1	2426	V: 1223897-1235455
Transcript:C39F7.2a.1	C39F7.2a.1	2453	V: 1223902-1235445
Transcript:C39F7.2c.1	C39F7.2c.1	153	V: 1224046-1224995

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:C39F7.2a	C39F7.2a	2298	V: 1224046-1224139
CDS:C39F7.2b	C39F7.2b	2256	V: 1224046-1224139
CDS:C39F7.2c	C39F7.2c	153	V: 1224046-1224139

7 RNAi Result

• WBRNAi00011796
• WBRNAi00011797
• WBRNAi00042229
• WBRNAi00020824
• WBRNAi00080808
• WBRNAi00076206
• WBRNAi00065292

268 Allele

• WBVar01584508
• WBVar01584509
• WBVar01584510
• WBVar01584511
• WBVar01584512
• WBVar01584513
• WBVar01584514
• gk963591
• gk963553
• gk964259
• gk963850
• gk963899
• gk963027
• WBVar01970867
• WBVar01970869
• WBVar01970868
• WBVar01970870
• WBVar01970874
• WBVar01970873
• WBVar01970872
• WBVar01970871
• WBVar01970875
• gk952928
• gk700781
• gk226333
• WBVar01774732
• WBVar00202608
• WBVar00202607
• WBVar00202609
• WBVar00202602

1 Chromosome

• WormBase ID: V
• Organism: Caenorhabditis elegans
• Length (nt): 20924180

1 Chromosome Location

• Feature . Primary Identifier: WBGene00016539
• Start: 1223897
• End: 1235455
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrV_1221369..1223896
• Length (nt): 2528
• Chromosome Location: V: 1221369-1223896
• Organism: Caenorhabditis elegans

163 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L1-larva_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Transcripts that showed significantly increased expression in csr-1a(tor159) comparing to in N2 at 25C.	DESeq2, fold change > 2, p-value < 0.05.	WBPaper00061753:csr-1(tor159)_upregulated_25C
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
	Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO.	Fold change > 2.	WBPaper00064306:Agaro-oligosaccharides_upregulated
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure.	Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2).	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:S.aureus-4h_upregulated_N2
	Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals.	Sleuth	WBPaper00051558:aging_regulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome
Gamma irradiation 100 mGY per hour for 72 hours since L1 larva.	Transcripts that showed significantly increased expression after exposure to 100mGy per hour gamma irradiation from L1 to day 1 adult hermaphrodite stage.	DESeq2, FDR <= 0.05, log2 fold change >= 0.3 or <= -0.3.	WBPaper00058958:100mGy-irradiation-72h_upregulated
	Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in N2.	Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1.	WBPaper00053810:daf-2(e1370)_upregulated
	Transcripts that showed significantly altered expression at URX, AQR, and PQR neurons in camt-1(ok515) animals comparing to in wild type AX1888-1 strain.	RNA-seq data were mapped using PRAGUI - a Python 3-based pipeline for RNA-seq data analysis.	WBPaper00061902:camt-1(ok515)_regulated_URX-AQR-PQR
	Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals.	DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2.	WBPaper00062159:hda-2(ok1479)_upregulated
	Transcripts that showed significantly increased expression in srbc-48(ac23);kyIs262;fer-1(b232ts) comparing to in kyIs262;fer-1(b232ts), 24h after infection with P.aeruginosa.	DESeq2, FDR <0.05, fold change > 2.	WBPaper00059664:srbc-48(ac23)_upregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Allantoin_downregulated
	Transcripts that showed significantly decreased expression in set-2(tm1630) animals at embryo stage, comparing to in N2 animals.	DESeq2 (v2.1.8.3) was used to determine DE genes and to generate principal component and scatter plots. DE genes with FDR < 0.05 were analysed using g:Profiler with Bonferroni correction.	WBPaper00060014:set-2(tm1630)_downregulated
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(+), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(+)_vs_control_day2-adult

15 Expression Patterns

• Primary Identifier: Expr5475
• Remark: Strain: BC11195
• Reporter Gene: [C39F7.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTGGCGGCAAAATCTAAA] 3' and primer B 5' [GAGCTCTTCCTCGATTTTTGAA] 3'.
• Pattern: Adult Expression: Reproductive System; vulval muscle; spermatheca; head mesodermal cell; Nervous System; head neurons; Larval Expression: Reproductive System; developing vulva; head mesodermal cell; Nervous System; head neurons; tail neurons

• Primary Identifier: Expr9090
• Remark: Picture: Figure 4.
• Pattern: A rescuing madd-2::gfp transgene was expressed in most neurons, in hypodermis, and in muscle cells. In many neurons, madd-2::gfp expression was transient, peaking during periods of axon outgrowth and guidance. madd-2::gfp was most widely and strongly expressed in the embryo, particularly during the initial period of axon outgrowth at 350 to 400 min of development. At this stage, madd-2::gfp was prominent in the anterior embryo, including the developing neurons of the nerve ring, in the developing motor neurons of the ventral nerve cord, in posterior neurons, and in hypodermal cells. At ~430 min of development (1.5-fold stage), the madd-2::gfp transgene exhibited a more restricted pattern of expression in the anterior, ventral, and posterior regions of the embryo. The extinction of reporter gene expression in many neurons coincides with the period when most axons in the nerve ring and ventral cord have reached their targets. At the first larval stage, continued high expression of the madd-2::gfp transgene was observed in some head neurons, head muscles, ventral motor neurons, neurons in the tail, and hypodermal cells. As the animals developed from larvae into adults, madd-2::gfp expression decreased substantially in head and tail neurons. madd-2::gfp expression was detected in the HSN motor neurons around the third larval stage, during the period of its ventral axon outgrowth. Although reporter gene fusions should be interpreted with caution, these results suggest that MADD-2 could be present in many Netrin-responsive neurons at the time of axon guidance.
• Subcellular Localization: In most cells, MADD-2::GFP protein was in irregular puncta in the cytoplasm.

• Primary Identifier: Expr9286
• Pattern: Expression was found in vulval muscles and a few neurons, but not HSN or AVM neurons (data not shown).

• Primary Identifier: Expr9091
• Remark: Picture: Fig 3, Fig S1, S2, S3.
• Pattern: The expression pattern of MADD-2::GFP in animals carrying trIs31 was characterized in detail and is similar to the pattern observed in animals carrying trIs32. Weak MADD-2::GFP expression was first observed in the ventral blast cells during late gastrulation, followed by stronger expression in the overlying ventral hypodermal blast cells during enclosure. MADD-2::GFP expression can also be seen in myoblasts at the two-fold stage of development and persists in the BWMs throughout the life of the animal. From the three-fold stage of embryonic development, MADD-2::GFP is localized to the right side of the ventral hypodermal ridge and to the left side of the dorsal hypodermal ridge, where the ventral and dorsal major nerve cords, respectively, reside. MADD-2::GFP is also expressed in the vulval muscles, the anchor cell, the six ventral uterine precursor cells, the lateral seam cells, and the ray precursor cells and their descendents in males. Other ectodermal derivatives that express MADD-2::GFP include the hermaphrodite-specific neurons (HSNs), and some Q cell descendents, including the AVM, PVM, SDQr, and SDQl neurons.
• Subcellular Localization: Authors also expressed CFP-tagged MADD-2 in select body muscles by using the him-4 promoter. The him-4 promoter drives expression in the distal BWMs of each quadrant and not within the nervous system. In these transgenic animals, MADD-2::CFP is localized to the dense bodies and the muscle arm termini in a pattern that recapitulates MADD-2::GFP localization in strains carrying trIs31. Transgenic BWMs that are surrounded by nontransgenic cells show nearby localization of MADD-2::GFP at the hypodermal ridge, suggesting that MADD-2 is localized postsynaptically and not within axons. Within the BWMs, MADD-2::GFP is localized to the dense bodies that anchor thin fila ments to the extracellular matrix.

• Primary Identifier: Expr12915
• Pattern: MADD-2::GFP is expressed in intestinal cells in a complex and dynamic pattern. MADD-2::GFP is expressed at a low level in all intestinal cells before 297 minutes, but in older embryos expression is lost in the int1 ring and in most R cells. Interestingly, MADD-2::GFP is expressed asymmetrically in the L cells of the int2-int4 rings.

• Primary Identifier: Expr10618
• Pattern: A functional MADD-2: GFP reporter was strongly expressed in the AC and more weakly in the adjacent uterine cells around the time of invasion (Pn.px to Pn.pxx stages). The MADD-2: GFP signal was slightly polarized toward the basal side of the AC, where the invasive membrane forms.

• Primary Identifier: Expr11953
• Subcellular Localization: MADD-2::GFP was concentrated at the AC's invasive cell membrane in wild-type animals.

• Primary Identifier: Chronogram526
• Remark: Original chronogram file: chronogram.1543.xml
• Reporter Gene: [C39F7.2:gfp] transcriptional fusion.

• Primary Identifier: Expr1024761
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2013333
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr10807
• Pattern: In wild-type animals, MADD-2 translational reporter was preferentially expressed and diffusely distributed in vm2 cells. madd-2 transcriptional fusion was also expressed in vm2 cells.

• Primary Identifier: Expr1037089
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Chronogram1790
• Remark: Original chronogram file: chronogram.702.xml
• Reporter Gene: [C39F7.2:gfp] transcriptional fusion.

• Primary Identifier: Expr1146220
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2031565
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

26 GO Annotation

34 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00016539
• Start: 1223897
• End: 1235455
• Strand: -1

26 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 11559

1 Sequence Ontology Term

• Name: gene

4 Strains

• WBStrain00032432
• WBStrain00033425
• WBStrain00033426
• WBStrain00007190

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrV_1235456..1236857
• Length (nt): 1402
• Chromosome Location: V: 1235456-1236857
• Organism: Caenorhabditis elegans