WormMine: Gene WBGene00015124

• WormBase Gene ID: WBGene00015124
• Gene Name: anmt-1
• Sequence Name: B0303.2
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable N-methyltransferase activity. Predicted to be involved in methylation. Located in striated muscle dense body and striated muscle myosin thick filament. Human ortholog(s) of this gene implicated in abdominal aortic aneurysm; coronary artery disease; and renal cell carcinoma. Is an ortholog of human NNMT (nicotinamide N-methyltransferase).
• Biotype: SO:0001217
• Genetic Position: III :-0.101376±
• Length (nt): 1601

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00015124

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:B0303.2.1	B0303.2.1	905	III: 8684808-8686408
Transcript:B0303.2.2	B0303.2.2	895	III: 8684809-8686399

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:B0303.2	B0303.2	822	III: 8684809-8684895

3 RNAi Result

• WBRNAi00038901
• WBRNAi00005557
• WBRNAi00028074

31 Allele

• gk964518
• gk963887
• gk823812
• gk507001
• gk426279
• gk426278
• gk498944
• gk519521
• gk692438
• gk901149
• gk386476
• gk317894
• gk537483
• WBVar01266483
• h5960
• h6513
• WBVar01331632
• gk457
• WBVar01939390
• WBVar01723041
• WBVar00069343
• WBVar01645711
• WBVar01567025
• WBVar00564433
• WBVar00069323
• gk180641
• WBVar00069338
• WBVar00066275
• WBVar00066280
• WBVar01629091

1 Chromosome

• WormBase ID: III
• Organism: Caenorhabditis elegans
• Length (nt): 13783801

1 Chromosome Location

• Feature . Primary Identifier: WBGene00015124
• Start: 8684808
• End: 8686408
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

102 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_upregulated
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_developing
	Genes with expression level regulated by genotype (N2 vs CB4856) at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_regulated_developing
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_downregulated
Bacteria infection: Staphylococcus aureus	Transcripts that showed significantly decreased expression in animals experimentally colonised by a wild microbiota community and infected by the widespread animal pathogen, Staphylococcus aureus, comparing to animals not colonized by microbiota and not infected by pathogen.	DeSeq2 (v. 1.42.0), Wald analyses testing against a null hypothesis of < |1.5|-fold change in gene expression between treatments (BenjaminiHochberg adjusted false detection rate of p <= 0.05.	WBPaper00067479:Microbiota-Pathogen_vs_control_downregulated
Bacteria infection: Staphylococcus aureus	Transcripts that showed significantly decreased expression in animals experimentally colonised by a wild microbiota community and infected by the widespread animal pathogen, Staphylococcus aureus, comparing to animals colonized by microbiota but not infected by pathogen.	DeSeq2 (v. 1.42.0), Wald analyses testing against a null hypothesis of < |1.5|-fold change in gene expression between treatments (BenjaminiHochberg adjusted false detection rate of p <= 0.05.	WBPaper00067479:Microbiota-Pathogen_vs_Microbiota_downregulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts that showed significantly increased expression in wdr-5(ok1417);skn-1(lax188) comparing to in skn-1(lax188) at day 2 adult stage.	fold change > 2	WBPaper00058711:wdr-5(ok1417)_upregulated
	Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:hda-1(ne4752)_upregulated
	Transcripts that showed significantly increased expression in mep-1(ne4629[MEP-1-GFP-Degron]) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:mep-1(ne4629)_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:PVD-OLL-neurons_L3-L4-larva_expressed
	Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals.	DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2.	WBPaper00062159:hda-2(ok1479)_upregulated
Bacteria infection: Pseudomonas aeruginosa PA14. 4 hours at 25C.	Transcripts that showed significantly decreased expression after N2 L4 animals were infected by P. aeruginosa (PA14) bacteria for 24 hours at 25C.	DESeq R package (1.18.0), FDR < 0.05 and fold change > 2.	WBPaper00062184:PA14_downregulated
	Transcripts that showed significantly increased expression in srbc-48(ac23);kyIs262;fer-1(b232ts) comparing to in kyIs262;fer-1(b232ts), 24h after infection with P.aeruginosa.	DESeq2, FDR <0.05, fold change > 2.	WBPaper00059664:srbc-48(ac23)_upregulated
	Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066594:ilc-17.1(syb5296)_upregulated
	Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis.	To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq.	WBPaper00045521:Gender_Neutral
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(+), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(+)_vs_control_day2-adult
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(-), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(-)_vs_control_day2-adult
	Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014.	N.A.	WBPaper00026929:sir-2.1_overexpression_regulated
	Transcripts of coding genes that showed significantly increased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_enriched_coding-RNA
	Genes expressed in N2.	Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0.	WBPaper00025141:N2_Expressed_Genes
	Transcripts that showed significantly increased expression in daf-2(e1370) neurons comparing to in N2 neurons at day 8adult stage.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00066978:daf-2(e1370)_upregulated_neuron
	Transcripts that showed significantly increased expression in daf-16(mu86);daf-2(e1370) neurons comparing to in daf-2(e1370) neurons at day 8adult stage.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00066978:daf-16(mu86)_upregulated_neuron
heat-shock hlh-1	Genes enriched in HLH-1 heat shock dataset.	A two-class unpaired analysis was performed to identify genes that are elevated 1.7-fold or greater when compared with the reference for each dataset, at a false discovery rate of 1.8% or less for M0 and 1.2% or less for the M24 datasets.	WBPaper00031003:hlh_1_enriched

9 Expression Patterns

• Primary Identifier: Expr4314
• Pattern: Detected exclusively outside the nervous system.

• Primary Identifier: Expr5044
• Remark: Strain: BC10157
• Reporter Gene: [B0303.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCGATTCCTTTGACGAATTGTA] 3' and primer B 5' [CCGGTGATCTGAATACACACA] 3'.
• Pattern: Adult Expression: pharynx; Reproductive System; uterine muscle; vulval muscle; body wall muscle; Larval Expression: pharynx; intestine; body wall muscle

• Primary Identifier: Expr2009338
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr9357
• Pattern: Adult Expression: pharynx; Reproductive System; uterine muscle; vulval muscle; body wall muscle. Larval Expression: pharynx; intestine; body wall muscle
• Subcellular Localization: Sub-cellular localization within the body wall muscle: Myofilaments +/- Dense bodies

• Primary Identifier: Expr1036462
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr1022909
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Chronogram1202
• Remark: Original chronogram file: chronogram.2325.xml
• Reporter Gene: [B0303.2:gfp] transcriptional fusion.

• Primary Identifier: Expr2027574
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1143084
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

10 GO Annotation

10 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00015124
• Start: 8684808
• End: 8686408
• Strand: 1

10 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 1601

1 Sequence Ontology Term

• Name: gene

3 Strains

• WBStrain00026545
• WBStrain00036290
• WBStrain00001201

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrIII_8683737..8684807
• Length (nt): 1071
• Chromosome Location: III: 8683737-8684807
• Organism: Caenorhabditis elegans