WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00016828 Gene Name  sre-52
Sequence Name  ? C50E10.5 Organism  Caenorhabditis elegans
Automated Description  Predicted to be involved in sensory perception of chemical stimulus. Predicted to be located in membrane. Expressed in PVT. Biotype  SO:0001217
Genetic Position  II :8.3542 ±0.077558 Length (nt)  ? 2364
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00016828

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:C50E10.5.1 C50E10.5.1 1086   II: 12335730-12338093
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:C50E10.5 C50E10.5 1086   II: 12335730-12336202

6 RNAi Result

WormBase ID
WBRNAi00042902
WBRNAi00012216
WBRNAi00023100
WBRNAi00023174
WBRNAi00023686
WBRNAi00023974

76 Allele

Public Name
gk963801
gk963053
gk962684
gk964116
WBVar02067096
WBVar02067095
WBVar01605479
h15132
otn14473
WBVar01936169
WBVar02074664
WBVar02076359
WBVar01983032
WBVar01383810
WBVar01383799
WBVar00106173
WBVar01400540
WBVar01835460
WBVar01835461
WBVar01836194
WBVar01949346
WBVar01394516
WBVar01960479
gk577062
gk520423
gk796558
gk853501
gk942428
WBVar01414212
WBVar02052368

1 Chromosome

WormBase ID Organism Length (nt)
II Caenorhabditis elegans 15279421  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00016828 12335730 12338093 1

3 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrII_12338094..12339943   1850 II: 12338094-12339943 Caenorhabditis elegans

29 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology. DESEQ2, fold change > 2 and FDR < 0.01. WBPaper00062103:neuron_enriched
  Transcripts that showed significantly increased expression in csr-1a(tor159) comparing to in N2 at 25C. DESeq2, fold change > 2, p-value < 0.05. WBPaper00061753:csr-1(tor159)_upregulated_25C
  Transcripts that showed significantly increased expression in ogt-1(ok1474) neuronal cells isolated by FACs comparing to in FACs isolated neuronal cells from wild type. DESeq2, fold change > 2, FDR < 0.05. WBPaper00066485:ogt-1(ok1474)_upregulated_neuron
  Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage. DESeq2, fold change > 2, FDR < 0.05. WBPaper00066594:ilc-17.1(syb5296)_upregulated
  Transcripts that showed significantly decreased expression in eat-2(ad1116) comparing to in N2 at 3-days post L4 adult hermaphrodite animals. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:eat-2(ad1116)_downregulated
  Transcripts that showed significantly decreased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Psora-Allantoin_downregulated
  Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 250uM Allantoin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rapamycin-Allantoin_downregulated
  Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 50uM Rifampicin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rapamycin-Rifampicin_downregulated
  Genes with significantly increased expression in eat-2(ad465) treated with 2% DMSO for 72 hours, comparing to in N2 treated with 2% DMSO for 72 hours. Analysis of gene expression data was carried out with the Affymetrix Transcriptome Analysis Console. Data preprocessing (using RMA normalization) and QC metrics were performed using Affymetrix Expression Console TM and manually inspected afterwards. Expression analysis was carried out for each two pairwise conditions. FDR statistical correction for multiple testing resulted in a slightly lower number of DEGs in most cases. P-value < 0.05 and fold change > 2.0 were used to determine differentially expressed genes. WBPaper00048989:eat-2(ad465)_upregulated_in-DMSO
  Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014. N.A. WBPaper00026929:sir-2.1_overexpression_regulated
  Transcripts that showed significantly increased expression in daf-2(e1370) neurons comparing to in N2 neurons at day 8adult stage. DESeq2, FDR < 0.05, fold change > 2. WBPaper00066978:daf-2(e1370)_upregulated_neuron
  Transcripts that showed significantly increased expression in daf-16(mu86);daf-2(e1370) neurons comparing to in daf-2(e1370) neurons at day 8adult stage. DESeq2, FDR < 0.05, fold change > 2. WBPaper00066978:daf-16(mu86)_upregulated_neuron
  Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin, 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rapamycin-Rifampicin-Allantoin_downregulated
  Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rapamycin_downregulated
  Transcripts that showed significantly decreased expression after animals were treated with 50uM Rifampicin and 100uM Psora from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rifampicin-Psora_downregulated
Bacteria infection: Serratia marcesens Genes up-regulated in animals infected with Serratia marcesens compared to the E. coli OP50 control after 24h of infection. MAANOVA and BRB-Array-Tools. WBPaper00030985:Serratia_marcesens_upregulated
  Genes that showed significantly increased expression level in rsr-2(RNAi) animals comparing to in gfp(RNAi) control. Fold change > 1.2 or < 0.8. WBPaper00042477:rsr-2(RNAi)_upregulated_TilingArray
  Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin, 50uM Rifampicin and 100uM Psora from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rapamycin-Rifampicin-Psora_downregulated
  Transcripts that showed significantly increased expression in unc-70(cas983) comparing to in N2 at L1 larva stage. DESeq2, fold change >= 2, FDR <= 0.05 WBPaper00057041:unc-70(cas983)_upregulated
  Transcripts that showed significantly decreased expression in nfki-1(cer1) animals at L4 larva stage, comparing to in N2 animals. Differentially expressed genes between wild type and knockouts were explored using DESeq2 R package (v.1.20.0) considering a threshold of adjusted p value < 0.01. WBPaper00060445:nfki-1(cer1)_downregulated_L4
  Genes that showed significantly increased expression after exposure to adsorbable organic bromine compounds (AOBr) contained in M. aeruginosa batch culture. Differentially expressed genes (DEGs) were identified with a random variance t-test and a significance analysis of microarrays (SAM) test. Genes were considered statistically significant if their p-value was less than 0.05, the false discovery rate less than 0.3, and the fold change compared to control at least <= 0.67 or >=1.5. WBPaper00046853:AOBr_M.aeruginosa-batch-culture_upregulated
  Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin, 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rapamycin-Psora-Allantoin_downregulated
  Coexpression clique No. 211, srj-42-srw-113, on the genome-wide coexpression clique map for the nematode GPL200 platform. All available microarray datasets for the GPL200 platform (Affymetrix C. elegans Genome Array) were obtained from the GEO repository. This included 2243 individual microarray experiments. These were normalized against each other with the software RMAexpress (Bolstad, 2014). Based on these normalized values, Pearsons correlation coefficients were obtained for each probe-probe pair of the 22,620 probes represented on this array type. The resulting list of correlation coefficients was then ranked to generate the ranked coexpression database with information on each probe represented on the GPL200 platform. WBPaper00061527:srj-42-srw-113
  Transcripts that showed significantly increased expression in nfki-1(cer1) animals at L1 larva stage, comparing to in N2 animals. Differentially expressed genes between wild type and knockouts were explored using DESeq2 R package (v.1.20.0) considering a threshold of adjusted p value < 0.01. WBPaper00060445:nfki-1(cer1)_upregulated_L1
  Top 300 transcripts enriched in ABalpapppa, ABarapappa according to single cell RNAseq. Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm. WBPaper00061340:I1_parent
  Transcripts that showed significantly increased expression in spc-1(cas971) comparing to in N2 at L1 larva stage. DESeq2, fold change >= 2, FDR <= 0.05 WBPaper00057041:spc-1(cas971)_upregulated
  Genes altered by more than 2-Fold in late versus early generation prg-1 mutants and prg-1; daf-2 mutants. Samples include prg-1(pk2290), prg-1(n4357), prg-1(tm872), prg-1(pk2290); daf-2(e1368), prg-1(pk2290); daf-2(e1370), prg-1(tm872); daf-2(e1370), prg-1(tm872); daf-2(m41). Genes with more than 2-fold change in expression level are considered differentially expressed. WBPaper00045217:prg-1_progressively_regulated
Reduced humidity (98% relative humidity). Genes that were up-regulated after one day exposure to reduced humidity (98% relative humidity) according to microarray analysis. Multiple hypothesis testing with the Benjamini-Hochberg correction was applied on calculated p-values. A change in the expression level was considered to be significant if the adjusted p-value was less than 0.001. WBPaper00044578:reduced-humidity_upregulated_microarray

6 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr2034531 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
Also expressed in (comments from author) : No comments. Strain: BC11973 [sre-52::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TAGGCAGGAACAAAAAGTAGCTG] 3' and primer B 5' [TGATTTTGTTACTTAGGGGGAAAA] 3'. Expr5554 Adult Expression: intestine; Larval Expression: intestine; Nervous System; head neurons; tail neurons;  
    Expr14046 1-3 head neuron pairs (quite dim and variable), PVT  
    Expr2016305 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1146874 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr1017273 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

4 GO Annotation

Annotation Extension Qualifier
  located_in
  involved_in
  located_in
  located_in

0 Homologues

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00016828 12335730 12338093 1

4 Ontology Annotations

Annotation Extension Qualifier
  located_in
  involved_in
  located_in
  located_in

0 Regulates Expr Cluster

1 Sequence

Length
2364

1 Sequence Ontology Term

Identifier Name Description
gene  

1 Strains

WormBase ID
WBStrain00001969

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrII_12335081..12335729   649 II: 12335081-12335729 Caenorhabditis elegans