WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00017272 Gene Name  F08F8.7
Sequence Name  ? F08F8.7 Organism  Caenorhabditis elegans
Automated Description  Predicted to enable D-ribulose-phosphate 3-epimerase activity and metal ion binding activity. Predicted to be involved in carbohydrate metabolic process and pentose-phosphate shunt, non-oxidative branch. Predicted to be located in cytosol. Is an ortholog of human RPEL1 (ribulose-5-phosphate-3-epimerase like 1). Biotype  SO:0001217
Genetic Position  Length (nt)  ? 1295
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00017272

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:F08F8.7.2 F08F8.7.2 788   III: 7345855-7347142
Transcript:F08F8.7.1 F08F8.7.1 795   III: 7345855-7347149
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:F08F8.7 F08F8.7 684   III: 7345959-7346156

4 RNAi Result

WormBase ID
WBRNAi00044032
WBRNAi00110511
WBRNAi00110524
WBRNAi00110492

19 Allele

Public Name
gk964518
gk963887
otn17955
WBVar01330690
WBVar01817900
gk178248
gk178247
gk555133
gk178244
gk178246
WBVar01416079
gk178245
WBVar00064812
WBVar01701768
gk414199
gk617805
gk533324
gk695419
gk882885

1 Chromosome

WormBase ID Organism Length (nt)
III Caenorhabditis elegans 13783801  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00017272 7345855 7347149 -1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

0 Downstream Intergenic Region

77 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rifampicin-Allantoin_upregulated
  Transcripts that showed significantly increased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Psora-Allantoin_upregulated
  Transcripts that showed significantly increased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rapamycin-Metformin_upregulated
  Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:GABAergic-neuron_expressed
  Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:intestine_expressed
  Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:NMDA-neuron_expressed
  Maternal class (M): genes that are called present in at least one of the three PC6 replicates. A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. [cgc5767]:expression_class_M
  Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic. A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. [cgc5767]:expression_class_SM
  Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy. Cufflinks WBPaper00065120:body-muscle-transcriptome
  Transcripts that showed significantly increased expression in nuo-6(qm200) comparing to in N2. Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1. WBPaper00053810:nuo-6(qm200)_upregulated
  Transcripts detected in germline isolated from day-1 adult hermaphrodite animals. All three experiments have CPM >= 1. WBPaper00067147:germline_expressed
  Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis. To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq. WBPaper00045521:Gender_Neutral
  Proteins identified in extracellular vesicle. N.A. WBPaper00062669:extracellular-vesicle_protein
  Up-regulated genes (fold change > 1.5) in two CoQ-deficient clk-1 mutant strains (e2519, qm30) compared to wild types N2. Fold-changes of intensities were calculated from the arithmetic mean of gene expression values between experimental and corresponding control group. Fold change >= 1.5 was used as cut-off. WBPaper00045774:clk-1_upregulated
Starvation 48 hours at L1 arrest Transcripts that showed significantly increased expression in starved N2 animals (48 hours at L1 arrest) Fold change > 2. WBPaper00064005:starvation_upregulated_N2_mRNA
  TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood. SAM WBPaper00031040:TGF-beta_adult_downregulated
  Genes expressed in N2. Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0. WBPaper00025141:N2_Expressed_Genes
  Transcripts that showed significantly increased expression in emb-4(hc60) comparing to in N2. DESeq2 WBPaper00052884:emb-4(hc60)_upregulated
  Transcripts that showed significantly decreased expression in bcf-1(ylf1) comparing to in N2 adult animals. DESeq2 WBPaper00064933:bcf-1(ylf1)_downregulated_transcript
  Transcripts that showed differential expression between 24 and 26 hours post hatching L2d and dauer committed larvae of daf-9(dh, triggered by the dafachronic acid (DA) growth hormone6). Cluster 2 genes' expression gradually increased into dauer. Benjamini Hochberg corrected q-value < 0.01. WBPaper00053388:dauer_regulated_Cluster2
  Transcripts with significantly increased expression in isp-1(qm150) vs. N2, and in isp-1(qm150) ced-4(n1162) vs. ced-4(n1162). Comparisons of each genotype were compared to the wild-type using the Empirical Base (Wright & Simon) algorithm and fold changes were represented on a log2 scale. A threshold of p < 0.05 and a fold change of 1.3 (log2) was set to determine differentially expressed targets. WBPaper00045263:isp-1(qm150)_upregulated
  Transcripts with significantly increased expression in nuo-6(qm200) vs. N2, and in nuo-6(qm200);ced-4(n1162) vs. ced-4(n1162). Comparisons of each genotype were compared to the wild-type using the Empirical Base (Wright & Simon) algorithm and fold changes were represented on a log2 scale. A threshold of p < 0.05 and a fold change of 1.3 (log2) was set to determine differentially expressed targets. WBPaper00045263:nuo-6(qm200)_upregulated
  Genes that showed more than 1.5-fold decrease of expression following (Pore-Forming Toxin) PFT treatment by Cry5B. Linear Models for Microarray Data (LIMMA) was used to determine a set differentially expressed genes. The cutoff p-value used was 0.01 with minimum 1.5 or 2 fold change. WBPaper00038231:Cry5B_1.5-fold_downregulated
  Genes that showed more than 2-fold decrease of expression following (Pore-Forming Toxin) PFT treatment by Cry5B. Linear Models for Microarray Data (LIMMA) was used to determine a set differentially expressed genes. The cutoff p-value used was 0.01 with minimum 1.5 or 2 fold change. WBPaper00038231:Cry5B_2-fold_downregulated
  Total muscle depleted genes (complete list of non-overlapping genes from the 0hr and 24hr muscle depleted datasets). A two-class unpaired analysis was performed to identify genes that are elevated 1.7-fold or greater when compared with the reference for each dataset, at a false discovery rate of 1.8% or less for M0 and 1.2% or less for the M24 datasets. WBPaper00031003:total_muscle_depleted
  Transcripts enriched in germline by comparing dissected germline tissue with dissected intestine tissue, both injected with empty RNAi vector. Genes were determined germline-enriched if the lowest expression value (log2(FPKM+1)) observed in the germline empty vector samples was at least 2-fold higher than the highest expression value observed in the intestine empty vector samples. WBPaper00051039:germline_enriched
Treatment with 0.2mM of HuminFeed until young adult stage (3 days). Gene significantly up-regulated by treatment with 0.2mM of HuminFeed until young adult stage (3 days), with a minimum fold change in gene expression of 1.25. For selection of DEGs, an unpaired t -test was performed followed by a significance analysis of microarray (SAM) test including a calculation that estimates the false discovery rate (FDR). FDR, reducing on the one hand type I errors for null associations, was set to a non-stringent level of <12.5%, mainly to guard from an increase of type II error and also based on findings by Levine et al. (2011), which described 12.5% as most acceptable optimum level of FDR, representing the 90th percentile of the normal distribution curve. DEGs exceeding a fold change of 1.25 were further analyzed with respect to their functional clustering. This fold-cut-off was chosen to allow an interpretation that is biologically meaningful, akin to the notion that data of sound technical and experimental quality which returns strong, statistically significant, absolute signal intensities is sufficiently robust to justify a fold-cut-off of >1.2. This analysis was conducted using the functional annotation clustering tool of the Database for Annotation, Visualization, and Integrated Discovery (DAVID; Huang et al., 2007). WBPaper00041002:HF_3d_0.2mM_Up
Treatment with 2.0mM of HuminFeed until young adult stage (3 days). Gene significantly up-regulated by treatment with 2.0mM of HuminFeed until young adult stage (3 days), with a minimum fold change in gene expression of 1.25. For selection of DEGs, an unpaired t -test was performed followed by a significance analysis of microarray (SAM) test including a calculation that estimates the false discovery rate (FDR). FDR, reducing on the one hand type I errors for null associations, was set to a non-stringent level of <12.5%, mainly to guard from an increase of type II error and also based on findings by Levine et al. (2011), which described 12.5% as most acceptable optimum level of FDR, representing the 90th percentile of the normal distribution curve. DEGs exceeding a fold change of 1.25 were further analyzed with respect to their functional clustering. This fold-cut-off was chosen to allow an interpretation that is biologically meaningful, akin to the notion that data of sound technical and experimental quality which returns strong, statistically significant, absolute signal intensities is sufficiently robust to justify a fold-cut-off of >1.2. This analysis was conducted using the functional annotation clustering tool of the Database for Annotation, Visualization, and Integrated Discovery (DAVID; Huang et al., 2007). WBPaper00041002:HF_3d_2.0mM_Up

6 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr2020521 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
Strain: BC12846 [F08F8.7::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAGGAGAATGACCATATAAACGC] 3' and primer B 5' [GGACGGAGGGTGATCTGA] 3'. Expr5686 Adult Expression: intestine; Larval Expression: intestine;  
    Expr1017332 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr1147998 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr2002302 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
Original chronogram file: chronogram.370.xml [F08F8.7:gfp] transcriptional fusion. Chronogram1496    

13 GO Annotation

Annotation Extension Qualifier
  located_in
  involved_in
  involved_in
  involved_in
  involved_in
  enables
  enables
  enables
  enables
  enables
  enables
  enables
  enables

7 Homologues

Type
orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00017272 7345855 7347149 -1

13 Ontology Annotations

Annotation Extension Qualifier
  located_in
  involved_in
  involved_in
  involved_in
  involved_in
  enables
  enables
  enables
  enables
  enables
  enables
  enables
  enables

0 Regulates Expr Cluster

1 Sequence

Length
1295

1 Sequence Ontology Term

Identifier Name Description
gene  

1 Strains

WormBase ID
WBStrain00002361

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrIII_7347150..7347233   84 III: 7347150-7347233 Caenorhabditis elegans