Genomics
2 Transcripts
WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
---|---|---|---|
Transcript:C18G1.2a.1 | C18G1.2a.1 |
841
![]() |
V: 4770670-4773086 |
Transcript:C18G1.2b.1 | C18G1.2b.1 |
351
![]() |
V: 4771838-4772886 |
Other
2 CDSs
WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
---|---|---|---|
CDS:C18G1.2a | C18G1.2a |
597
![]() |
V: 4770714-4770835 |
CDS:C18G1.2b | C18G1.2b |
351
![]() |
V: 4771838-4771999 |
35 Allele
Public Name |
---|
gk963301 |
gk963591 |
gk963553 |
gk964259 |
gk964351 |
gk963850 |
WBVar01861556 |
WBVar01861558 |
WBVar01861557 |
WBVar01861559 |
WBVar01861561 |
WBVar01861560 |
WBVar01710354 |
tm840 |
gk358759 |
gk501694 |
gk644897 |
gk848496 |
gk617423 |
gk904210 |
gk801986 |
gk492788 |
gk912411 |
gk568455 |
gk634924 |
gk874863 |
WBVar01650781 |
WBVar01650782 |
gk233679 |
gk233680 |
1 Chromosome Location
Feature . Primary Identifier |
Start | End | Strand |
---|---|---|---|
WBGene00015981 | 4770670 | 4773086 | 1 |
4 Data Sets
Name | URL |
---|---|
WormBaseAcedbConverter | |
GO Annotation data set | |
C. elegans genomic annotations (GFF3 Gene) | |
Panther orthologue and paralogue predictions |
1 Downstream Intergenic Region
WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
---|---|---|---|---|---|
intergenic_region_chrV_4773087..4777959 | 4873 | V: 4773087-4777959 | Caenorhabditis elegans |
125 Expression Clusters
Regulated By Treatment | Description | Algorithm | Primary Identifier |
---|---|---|---|
Genes with expression altered >= 3-fold in dpy-10(e128) mutants. | Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)). | WBPaper00035873:dpy-10_regulated | |
Transcripts of coding genes that showed significantly decreased expression in muscle. | DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. | WBPaper00062325:muscle_depleted_coding-RNA | |
Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. | DESeq. False discovry rate (FDR) < 0.1. | WBPaper00048988:neuron_expressed | |
adult vs dauer larva | Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. | N.A. | WBPaper00050488:adult_vs_dauer_regulated_N2_20C |
Osmotic stress | Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present | DESeq(version 1.10.1), FDR < 0.05. | WBPaper00050726:OsmoticStress_regulated_NoFood |
Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals. | Fold change > 2, FDR < 0.01. | WBPaper00065993:glp-1(e2141)_upregulated | |
Genes that were downregulated in lin-15B(n744). | For each gene in each microarray hybridization experiment, the ratio of RNA levels from the two samples was transformed into a log2 value and the mean log2 ratio was calculated. The log2 ratios were normalized by print-tip Loess normalization (Dudoit and Yang, 2002). All genes with a false discovery rate of <= 5% (q <= 0.05) (Storey and Tibshirani, 2003) and a mean fold-change ratio of >= 1.5 were selected for further analysis. | WBPaper00038168:lin-15B(n744)_downregulated | |
Bacteria infection: Enterococcus faecalis | Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50. | For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. | WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray |
Transcripts that showed significantly decreased expression at 11-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites. | DESeq2, fold change > 2, FDR < 0.05 | WBPaper00065835:Day11_vs_Day1_downregulated | |
Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:hypodermis_expressed | |
Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:intestine_expressed | |
Transcripts detected in germline isolated from day-1 adult hermaphrodite animals. | All three experiments have CPM >= 1. | WBPaper00067147:germline_expressed | |
Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage. | DESeq2 version 1.22.2, p < 0.05 | WBPaper00064716:paraquat_downregulated | |
Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage. | DESeq | WBPaper00053302:stavudine_24h_regulated | |
Genes that showed oscillating mRNA expression level throughout the 16 hour time courses from L3 larva to young adult. | The following three lines of R code were used to perform the classification: increasing <-2*amplitude-PC1 < -1.7; oscillating <-!increasing & (amplitude > 0.55); flat <-!increasing & !oscillating; Note that the amplitude of a sinusoidal wave corresponds to only half the fold change between trough and peak. | WBPaper00044736:oscillating_dev_expression | |
Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals. | Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R. | WBPaper00061479:hda-1(ne4752)_upregulated | |
Transcripts that showed significantly increased expression in srbc-48(ac23);kyIs262;fer-1(b232ts) comparing to in kyIs262;fer-1(b232ts), 24h after infection with P.aeruginosa. | DESeq2, FDR <0.05, fold change > 2. | WBPaper00059664:srbc-48(ac23)_upregulated | |
Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage. | DESeq2, fold change > 2, FDR < 0.05. | WBPaper00066594:ilc-17.1(syb5296)_upregulated | |
Bacteria: B.thuringiensis | Transcripts in elt-2(RNAi) animals that were significantly differentially expressed at least for one time point and one pathogenic strain Bt247 and Bt679 compared to the non pathogenic strain Bt407. | Cuffdiff | WBPaper00060358:B.thuringiensis_pathogen_regulated_elt-2(RNAi) |
Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(+), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage. | DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2. | WBPaper00050859:upregulated_P-granule(-)GFP(+)_vs_control_day2-adult | |
Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(-), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage. | DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2. | WBPaper00050859:upregulated_P-granule(-)GFP(-)_vs_control_day2-adult | |
Starvation 48 hours at L1 arrest | Transcripts that showed significantly increased expression in starved N2 animals (48 hours at L1 arrest) | Fold change > 2. | WBPaper00064005:starvation_upregulated_N2_mRNA |
Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014. | N.A. | WBPaper00026929:sir-2.1_overexpression_regulated | |
Transcripts that showed significantly altered expression after 24 hour exposure to nitroguanidine (NQ). | Multivariate permutation tests with random variance model implemented in BRB-Array Tools version 4.5 were performed to infer differentially expressed genes (DEGs). One thousand random permutations were computed per chemical class (i.e., a group of 16 arrays or samples). The confidence level of false discovery rate assessment was set at 80%, and the maximum allowed portion of false-positive genes was 10%. | WBPaper00055899:nitroguanidine_regulated | |
Bacteria infection: Serratia marcescens | Genes with increased expression after 24 hours of infection by S.marcescens Fold changes shown are pathogen vs OP50. | For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. | WBPaper00038438:S.marcescens_24hr_upregulated_TilingArray |
Genes expressed in N2. | Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0. | WBPaper00025141:N2_Expressed_Genes | |
Transcripts that showed significantly increased expression in lin-29(n333) comparing to in N2 at day 1 adult stage. | DESeq2, FDR < 0.01, fold change > 2. | WBPaper00066970:lin-29(n333)_upregulated | |
Transcripts that showed significantly increased expression in rict-1(mg360) comparing to in N2 at day 1 adult stage. | DESeq2, FDR < 0.01, fold change > 2. | WBPaper00066970:rict-1(mg360)_upregulated | |
Genes uniquely expressed in endoderm, according to RNAseq studies on blastomere (with isolated AB, MS, E, C, D founder cells dividing in vitro) time course and whole embryo time course. | Germ layers were assigned by correlating the average expression with germ-layer-specific patterns with a cutoff of 0.6 correlation with the following idealized vectors: endoderm = [00100]; ectoderm = [10000]; mesoderm = [01011], where the order is AB, MS, E, C and P3. Germ-layer genes were defined according to the sum of the genes identified by the clusters and are indicated in Fig. 2b. Authors further filtered the germ-layer gene sets by keeping only those genes whose expression was partitioned across the germ layers such that at least two-thirds of the expression was in that germ layer. | WBPaper00046121:endoderm_unique | |
Transcripts that showed significantly increased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals. | Fold change > 2, FDR < 0.05 | WBPaper00064088:Day-3-adult_vs_L4_upregulated_daf-16(mu86);glp-1(e2141) |
14 Expression Patterns
Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
---|---|---|---|---|
Expr4416 | elt-7 is expressed specifically in the E-lineage throughout later stages of embryogenesis. | |||
Strain: BC13738 | [C18G1.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAAACAACGGGTGAATAAATGAGT] 3' and primer B 5' [CCAGTCGACTAGAGCAGACAAC] 3'. | Expr5310 | Adult Expression: intestine; Larval Expression: intestine; | |
Strain: BC14487 | [C18G1.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAAACAACGGGTGAATAAATGAGT] 3' and primer B 5' [CCAGTCGACTAGAGCAGACAAC] 3'. | Expr5311 | Adult Expression: intestine; Larval Expression: intestine; | |
Picture: Fig. 1. | Expr9121 | It is continuously expressed at high levels exclusively in all cells of the gut lineage, starting at the 2E cell stage and progressing through adulthood. The expression appears strongest during embryogenesis and diminishe somewhat after hatching, consistent with endogenous expression measured in genome-wide microarray expression studies of embryonic and adult intestines. | ||
Expr9687 | elt-7 is expressed throughout the E lineage. | |||
Expr2011297 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
Expr1145012 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015 | |||
Original chronogram file: chronogram.806.xml | [C18G1.2:gfp] transcriptional fusion. | Chronogram1891 | ||
Expr10294 | Inferred expression. EPIC dataset. http://epic.gs.washington.edu/ Large-scale cellular resolution compendium of gene expression dynamics throughout development. This reporter was inferred to be expressing in this cell or one of its embryonic progenitor cells as described below. To generate a compact description of which cells express a particular reporter irrespective of time, the authors defined a metric "peak expression" for each of the 671 terminal ("leaf") cells born during embryogenesis. For each of these cells, the peak expression is the maximal reporter intensity observed in that cell or any of its ancestors; this has the effect of transposing earlier expression forward in time to the terminal set of cells. This metric allows straightforward comparisons of genes' cellular and lineal expression overlap, even when the expression occurs with different timing and despite differences in the precise time point that curation ended in different movies, at the cost of ignoring the temporal dynamics of expression, a topic that requires separate treatment. For simplicity, the authors use the term "expressing cells" to mean the number of leaf cells (of 671) with peak expression greater than background (2000 intensity units) and at least 10% of the maximum expression in that embryo. Quantitative expression data for all cells are located here: ftp://caltech.wormbase.org/pub/wormbase/datasets-published/murray2012/ | |||
Expr1200153 | Data from the TransgeneOme project | |||
Expr2029533 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
Expr1012253 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | |||
Expr1036832 | Tiling arrays expression graphs | |||
Original chronogram file: chronogram.467.xml | [C18G1.2:gfp] transcriptional fusion. | Chronogram1585 |
21 GO Annotation
Annotation Extension | Qualifier |
---|---|
located_in | |
located_in | |
located_in | |
enables | |
enables | |
involved_in | |
involved_in | |
enables | |
enables | |
enables | |
enables | |
enables | |
enables | |
located_in | |
located_in | |
involved_in | |
involved_in | |
involved_in | |
involved_in | |
involved_in | |
involved_in |
24 Homologues
Type |
---|
orthologue |
orthologue |
orthologue |
orthologue |
orthologue |
orthologue |
orthologue |
orthologue |
orthologue |
orthologue |
orthologue |
orthologue |
orthologue |
orthologue |
orthologue |
orthologue |
orthologue |
orthologue |
orthologue |
orthologue |
orthologue |
orthologue |
orthologue |
orthologue |
21 Ontology Annotations
Annotation Extension | Qualifier |
---|---|
located_in | |
located_in | |
located_in | |
enables | |
enables | |
involved_in | |
involved_in | |
enables | |
enables | |
enables | |
enables | |
enables | |
enables | |
located_in | |
located_in | |
involved_in | |
involved_in | |
involved_in | |
involved_in | |
involved_in | |
involved_in |
6 Regulates Expr Cluster
Regulated By Treatment | Description | Algorithm | Primary Identifier |
---|---|---|---|
Genes that are down-regulated in elt-2(ca15) larvae compared to elt-2(ca15);elt-7(tm840) larvae. | RNA-seq count data were filtered for detected genes (> 10 counts across all samples) and analyzed using DESeq. 2 with Cook's cutoff filtering set to FALSE. Genes were counted as differentially expressed if they registered a Benjamini-Hochberg corrected p-value less than 0.05 and a log2-fold change greater than 1.2 between any pair-wise conditional comparison. | WBPaper00053606:elt-2(ca15)_vs_elt-2(ca15);elt-7(tm840)_doenregulated | |
Genes that are up-regulated in elt-2(ca15) larvae compared to elt-2(ca15);elt-7(tm840) larvae. | RNA-seq count data were filtered for detected genes (> 10 counts across all samples) and analyzed using DESeq. 2 with Cook's cutoff filtering set to FALSE. Genes were counted as differentially expressed if they registered a Benjamini-Hochberg corrected p-value less than 0.05 and a log2-fold change greater than 1.2 between any pair-wise conditional comparison. | WBPaper00053606:elt-2(ca15)_vs_elt-2(ca15);elt-7(tm840)_upregulated | |
Genes that are up-regulated in wild-type N2 larvae compared to elt-2(ca15);elt-7(tm840) larvae. | RNA-seq count data were filtered for detected genes (> 10 counts across all samples) and analyzed using DESeq. 2 with Cook's cutoff filtering set to FALSE. Genes were counted as differentially expressed if they registered a Benjamini-Hochberg corrected p-value less than 0.05 and a log2-fold change greater than 1.2 between any pair-wise conditional comparison. | WBPaper00053606:N2_vs_elt-2(ca15);elt-7(tm840)_upregulated | |
Genes that are up-regulated in wild-type N2 larvae compared to elt-7(tm840) larvae. | RNA-seq count data were filtered for detected genes (> 10 counts across all samples) and analyzed using DESeq. 2 with Cook's cutoff filtering set to FALSE. Genes were counted as differentially expressed if they registered a Benjamini-Hochberg corrected p-value less than 0.05 and a log2-fold change greater than 1.2 between any pair-wise conditional comparison. | WBPaper00053606:N2_vs_elt-7(tm840)_upregulated | |
Genes that are down-regulated in wild-type N2 larvae compared to elt-2(ca15);elt-7(tm840) larvae. | RNA-seq count data were filtered for detected genes (> 10 counts across all samples) and analyzed using DESeq. 2 with Cook's cutoff filtering set to FALSE. Genes were counted as differentially expressed if they registered a Benjamini-Hochberg corrected p-value less than 0.05 and a log2-fold change greater than 1.2 between any pair-wise conditional comparison. | WBPaper00053606:N2_vs_elt-2(ca15);elt-7(tm840)_downregulated | |
Genes that are down-regulated in wild-type N2 larvae compared to elt-7(tm840) larvae. In this case, no gene was downregulated. | RNA-seq count data were filtered for detected genes (> 10 counts across all samples) and analyzed using DESeq. 2 with Cook's cutoff filtering set to FALSE. Genes were counted as differentially expressed if they registered a Benjamini-Hochberg corrected p-value less than 0.05 and a log2-fold change greater than 1.2 between any pair-wise conditional comparison. | WBPaper00053606:N2_vs_elt-7(tm840)_downregulated |
1 Upstream Intergenic Region
WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
---|---|---|---|---|---|
intergenic_region_chrV_4769734..4770669 | 936 | V: 4769734-4770669 | Caenorhabditis elegans |