WormMine: Gene WBGene00017766

• WormBase Gene ID: WBGene00017766
• Gene Name: peli-1
• Sequence Name: F25B4.2
• Brief Description: F25B4.2 encodes a protein with similarity to the Pellino family of E3 ubiquitin ligases that function in regulation of Toll signaling; loss of F25B4.2 activity via RNAi results in embryonic arrest; an F25B4.2::mCherry promoter fusion is expressed in ciliated neurons, including the ASK, ADL, ASI, ASH, ASJ, PHA and PHB neurons, and in muscle cells during larval development; F25B4.2 expression in ciliated neurons is dependent upon the DAF-19 regulatory factor X (RFX) transcription factor; the product of F25B4.2 has been shown to physically interact with the MEX-3 KH domain protein.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable ubiquitin protein ligase activity. Predicted to be involved in protein polyubiquitination. Expressed in chemosensory neurons; ciliated neurons; and head. Human ortholog(s) of this gene implicated in colorectal cancer. Is an ortholog of human PELI2 (pellino E3 ubiquitin protein ligase family member 2) and PELI3 (pellino E3 ubiquitin protein ligase family member 3).
• Biotype: SO:0001217
• Genetic Position: V :-1.16999±
• Length (nt): 6527

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00017766

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F25B4.2.2	F25B4.2.2	2018	V: 5705810-5712336
Transcript:F25B4.2.1	F25B4.2.1	1774	V: 5709418-5712331

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F25B4.2	F25B4.2	1377	V: 5709422-5709525

3 RNAi Result

• WBRNAi00045466
• WBRNAi00013846
• WBRNAi00083272

103 Allele

• gk963301
• WBVar02060176
• gk963591
• gk963553
• gk964259
• gk964351
• gk963850
• WBVar01862384
• WBVar01862385
• WBVar01973592
• WBVar01973591
• WBVar01973593
• WBVar02023707
• WBVar01651656
• WBVar01651658
• WBVar01651657
• gk948367
• WBVar00209669
• WBVar00209668
• WBVar00209667
• WBVar00209666
• WBVar00209675
• WBVar00209672
• WBVar00209671
• WBVar00209674
• WBVar00209673
• WBVar00209670
• h5166
• gk808234
• gk814970

1 Chromosome

• WormBase ID: V
• Organism: Caenorhabditis elegans
• Length (nt): 20924180

1 Chromosome Location

• Feature . Primary Identifier: WBGene00017766
• Start: 5705810
• End: 5712336
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrV_5712337..5712927
• Length (nt): 591
• Chromosome Location: V: 5712337-5712927
• Organism: Caenorhabditis elegans

121 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Genes with expression altered >= 3-fold in dpy-10(e128) mutants.	Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)).	WBPaper00035873:dpy-10_regulated
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	Genes significantly enriched (> 2x, FDR < 5%) in a particular cell-type versus a reference sample of all cells at the same stage.	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:A-class-motor-neurons_larva_enriched
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
Bacteria diet: Sphingomonas aquatilis Yellow. Fed for 30 generations.	Transcripts that showed significantly decreased expression after fed by bacteria Sphingomonas aquatilis (Yellow) for 30 generations comparing to animals fed by E. coli OP50.	DESeq2 fold change > 2, p-value < 0.01.	WBPaper00061007:S.aquatilis_downregulated
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L2-larva_expressed
	Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066594:ilc-17.1(syb5296)_upregulated
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
	Transcripts that showed significantly decreased expression in nhl-2(ok818) comparing to in N2 at 25C.	EdgeR, FDR < 0.05, fold change < 0.5.	WBPaper00055971:nhl-2(ok818)_25C_upregulated
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(+), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(+)_vs_control_day2-adult
Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours.	Transcripts that showed significantly decreased expression in hpx-2(dg047) after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50.	Cuffcompare and Cuffdiff	WBPaper00056090:E.faecalis_downregulated_hpx-2(dg047)
	Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014.	N.A.	WBPaper00026929:sir-2.1_overexpression_regulated
	Genes expressed in N2.	Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0.	WBPaper00025141:N2_Expressed_Genes
	Genes that showed significantly decreased expression in wrn-1(gk99) comparing to in N2, according to RNAseq.	DESeq was used to calculate the fold changes, log fold changes, and significance of the changes for each comparison.	WBPaper00045934:wrn-1(gk99)_downregulated
	Embryonic class (E): genes that significantly increase in abundance at some point during embryogenesis.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_E
	Transcripts that showed significantly decreased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_downregulated
EtBr-exposed(maintained under normal lab light (mostly dark, in incubators) and exposed to EtBr (5ug/mL in agar).) vs UVC-exposed(exposed to 7.5 J/m2 UVC radiation 3 times, 24 h apart (48 h total).) at 3 h after the third UVC dose (51h), which is also 3 h after being placed on food.	Genes differentially expressed under EtBr treatment without UVC exposure vs after UVC exposure but without EtBr treatment at the -3h timepoint (3 h after the third UVC dose (51h), which is also 3 h after being placed on food).	Transcripts were defined as fold-change >1.2, p < 0.05 based on Rosetta Resolver analysis for all pairwise treatment comparisons. The fold-change refers to the second intensity over the first.	WBPaper00041939:EtBr-exposed_vs_UVC-exposed_51h
	Transcripts that showed significantly increased expression in jmjd-3.1p::jmjd-3.1 comparing to in N2.	DESeq2 Benjamini-Hochberg adjusted p-value < 0.05.	WBPaper00049545:jmjd-3.1(+)_upregulated
	Transcripts that showed significantly increased expression in rgef-1p::jmjd-1.2 comparing to in N2.	DESeq2 Benjamini-Hochberg adjusted p-value < 0.05.	WBPaper00049545:rgef-1p-jmjd-1.2(+)_upregulated
	Transcripts that showed significantly increased expression in sur-5p::jmjd-1.2 comparing to in N2.	DESeq2 Benjamini-Hochberg adjusted p-value < 0.05.	WBPaper00049545:sur-5p-jmjd-1.2(+)_upregulated
20C vs 25C	Transcripts that showed differential expression in 20C vs 25C in mir-34(gk437) animals at adult stage.	N.A.	WBPaper00050488:20C_vs_25C_regulated_mir-34(gk437)_adult
20C vs 25C	Transcripts that showed differential expression in 20C vs 25C in N2 animals at adult stage.	N.A.	WBPaper00050488:20C_vs_25C_regulated_N2_adult
	Transcripts that showed significantly increased expression in daf-16(mu86);fer-15(b26ts) comparing to in fer-15(b26ts) at 6-day or 7-day post L4 adult hermaphrodite stage.	DESeq2 (v1.18.1), ajusted p-value < 0.05	WBPaper00056218:daf-16(mu86)_upregulated_Day7
	Transcripts enriched in germline by comparing dissected germline tissue with dissected intestine tissue, both injected with empty RNAi vector.	Genes were determined germline-enriched if the lowest expression value (log2(FPKM+1)) observed in the germline empty vector samples was at least 2-fold higher than the highest expression value observed in the intestine empty vector samples.	WBPaper00051039:germline_enriched

13 Expression Patterns

• Primary Identifier: Expr5846
• Remark: Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC13263
• Reporter Gene: [F25B4.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAGCTGAAACGTCGGAGATAATAC] 3' and primer B 5' [CATCCACGATTAATCTGAAACTCA] 3'.
• Pattern: Adult Expression: Nervous System; head neurons; tail neurons; unidentified cells in head; Larval Expression: Nervous System; head neurons; tail neurons; unidentified cells in head

• Primary Identifier: Expr5847
• Remark: Strain: BC13759
• Reporter Gene: [F25B4.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAGCTGAAACGTCGGAGATAATAC] 3' and primer B 5' [CATCCACGATTAATCTGAAACTCA] 3'.
• Pattern: Adult Expression: Reproductive System; vulval muscle; body wall muscle; Nervous System; head neurons; neurons along body; tail neurons; Larval Expression: body wall muscle; Nervous System; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr5848
• Remark: Also expressed in (comments from author) : high intensity GFP Strain: BC13667
• Reporter Gene: [F25B4.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAGCTGAAACGTCGGAGATAATAC] 3' and primer B 5' [CATCCACGATTAATCTGAAACTCA] 3'.
• Pattern: Adult Expression: intestine; stomato-intestinal muscle; Reproductive System; vulva other; body wall muscle; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; Larval Expression: pharynx; intestine; stomato-intestinal muscle; body wall muscle; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons

• Primary Identifier: Expr7315
• Pattern: Click the movie links below for interactive 4D movies of a fluorescence reporter. http://glowormnotes.blogspot.com/2009/11/f25b42gfp-transcriptional-fusion.html

• Primary Identifier: Expr9675
• Pattern: Observation of mCherry signals indicates that F25B4.2 is expressed in ciliated neurons. Detailed analysis of F25B4.2 expression using dye-filling shows that F25B4.2 drives gene expression in ciliated neurons, including ASK, ADL, ASI, ASH, ASJ, PHA and PHB neurons. Expression in AWB was not found. Additional expression was also observed in muscle cells during larval stages but not in adults.

• Primary Identifier: Chronogram91
• Remark: Original chronogram file: chronogram.110.xml
• Reporter Gene: [F25B4.2:gfp] transcriptional fusion.

• Primary Identifier: Chronogram750
• Remark: Original chronogram file: chronogram.1788.xml
• Reporter Gene: [F25B4.2:gfp] transcriptional fusion.

• Primary Identifier: Expr1037630
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr2014819
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1149385
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Chronogram2051
• Remark: Original chronogram file: chronogram.96.xml
• Reporter Gene: [F25B4.2:gfp] transcriptional fusion.

• Primary Identifier: Expr1018005
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2033053
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

5 GO Annotation

14 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00017766
• Start: 5705810
• End: 5712336
• Strand: 1

5 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 6527

1 Sequence Ontology Term

• Name: gene

4 Strains

• WBStrain00002531
• WBStrain00002725
• WBStrain00002684
• WBStrain00002532

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrV_5705278..5705809
• Length (nt): 532
• Chromosome Location: V: 5705278-5705809
• Organism: Caenorhabditis elegans