WormMine: Gene WBGene00019844

• WormBase Gene ID: WBGene00019844
• Gene Name: abts-4
• Sequence Name: R03E9.3
• Brief Description: abts-4 encodes an anion transporter; ABTS-4::GFP fusion proteins are expressed solely in the intestine, with highest levels seen in the most anterior and posterior gut cells and subcellular localization restricted to the basolateral membrane.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable transmembrane transporter activity. Predicted to be involved in bicarbonate transport; regulation of intracellular pH; and transmembrane transport. Located in basolateral plasma membrane. Human ortholog(s) of this gene implicated in several diseases, including glucosephosphate dehydrogenase deficiency; hereditary elliptocytosis; and renal tubular acidosis. Is an ortholog of human SLC4A2 (solute carrier family 4 member 2) and SLC4A3 (solute carrier family 4 member 3).
• Biotype: SO:0001217
• Genetic Position: X :-2.45292 ±0.014058
• Length (nt): 14443

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00019844

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:R03E9.3a.1	R03E9.3a.1	3248	X: 6747296-6761738
Transcript:R03E9.3c.1	R03E9.3c.1	3126	X: 6747358-6761738
Transcript:R03E9.3b.1	R03E9.3b.1	2652	X: 6748424-6761696
Transcript:R03E9.3d.1	R03E9.3d.1	2646	X: 6751434-6761696

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:R03E9.3b	R03E9.3b	2652	X: 6748424-6748474
CDS:R03E9.3a	R03E9.3a	2871	X: 6747631-6747723
CDS:R03E9.3c	R03E9.3c	2811	X: 6747631-6747723
CDS:R03E9.3d	R03E9.3d	2646	X: 6751434-6751702

2 RNAi Result

• WBRNAi00051183
• WBRNAi00017357

211 Allele

• gk964260
• WBVar01927020
• WBVar01927021
• WBVar01927022
• WBVar01927023
• WBVar01927024
• WBVar01927025
• WBVar01927026
• gk962713
• tm10572
• gk960707
• gk963451
• gk963910
• WBVar02123737
• WBVar01690164
• WBVar02064430
• WBVar02064431
• WBVar02064429
• WBVar02064428
• WBVar01601876
• gk435156
• gk850308
• gk714043
• gk743169
• gk894293
• gk770115
• gk651365
• gk625567
• gk624528
• gk687781

1 Chromosome

• WormBase ID: X
• Organism: Caenorhabditis elegans
• Length (nt): 17718942

1 Chromosome Location

• Feature . Primary Identifier: WBGene00019844
• Start: 6747296
• End: 6761738
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrX_6744602..6747295
• Length (nt): 2694
• Chromosome Location: X: 6744602-6747295
• Organism: Caenorhabditis elegans

126 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_NoFood
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
	Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc).	DESeq2, fold change >= 2, FDR <= 0.01.	WBPaper00056826:SGP_biased
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Transcripts that showed differential expression between 24 and 26 hours post hatching L2d and dauer committed larvae of daf-9(dh6), triggered by the dafachronic acid (DA) growth hormone. Cluster 3 genes increased expression transiently at 26 hour post hatching.	Benjamini Hochberg corrected q-value < 0.01.	WBPaper00053388:dauer_regulated_Cluster3
	Transcripts that showed significantly increased expression in animals with germline-specific inx-14(RNAi) comparing to in aniamls fed with control vector, both exposed to PA14 infection.	DESeq2. Differentially-expressed genes (DEG) were identified based on two criteria: FDR (False discovery rateusing Benjamini-Hochberg adjusted p-values) < 0.01 and absolute value of log2(Fold Change) > 1.	WBPaper00066146:germline-inx-14(RNAi)_upregulated_PA14
	Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in N2.	Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1.	WBPaper00053810:daf-2(e1370)_upregulated
	Transcripts that showed significantly altered expression at URX, AQR, and PQR neurons in camt-1(ok515) animals comparing to in wild type AX1888-1 strain.	RNA-seq data were mapped using PRAGUI - a Python 3-based pipeline for RNA-seq data analysis.	WBPaper00061902:camt-1(ok515)_regulated_URX-AQR-PQR
	Transcripts that showed significantly increased expression in hda-1(RNAi) embryos comparing to control animals.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00067044:hda-1(RNAi)_upregulated
	Transcripts that showed significantly increased expression in pry-1(mu38) animals comparing to in N2 at L1 larva stage.	DESeq, FDR < 0.05	WBPaper00055626:pry-1(mu38)_upregulated
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
Bacteria: B.thuringiensis	Transcripts in elt-2(RNAi) animals that were significantly differentially expressed at least for one time point on the non pathogenic strain Bt407 compared to E. coli OP50.	Cuffdiff	WBPaper00060358:B.thuringiensis_non-pathogen_regulated_elt-2(RNAi)
Bacteria: B.thuringiensis	Transcripts in elt-2(RNAi) animals that were significantly differentially expressed at least for one time point and one pathogenic strain Bt247 and Bt679 compared to the non pathogenic strain Bt407.	Cuffdiff	WBPaper00060358:B.thuringiensis_pathogen_regulated_elt-2(RNAi)
	Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis.	To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq.	WBPaper00045521:Gender_Neutral
	Genes that showed increased expression after germline ablation comparing to un-ablated animals.	The differential expression between germline-ablated versus gonad-ablated animals was computed via the functions makeContrasts and contrasts.fit in the limma package in R/Bioconductor.	WBPaper00045571:germline-ablation_upregulated
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(+), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(+)_vs_control_day2-adult
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(-), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(-)_vs_control_day2-adult
	Transcripts that showed significantly increased expression in pgl-1(ct131) animals (isolated from SS0002[pgl-1(ct131)him-3(e1147)], comparing to in control animals SS1174, at 1-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_pgl-1(ct131)_vs_control_day1-adult
	Genes with significantly increased expression in eat-2(ad465) treated with 2% DMSO for 72 hours, comparing to in N2 treated with 2% DMSO for 72 hours.	Analysis of gene expression data was carried out with the Affymetrix Transcriptome Analysis Console. Data preprocessing (using RMA normalization) and QC metrics were performed using Affymetrix Expression Console TM and manually inspected afterwards. Expression analysis was carried out for each two pairwise conditions. FDR statistical correction for multiple testing resulted in a slightly lower number of DEGs in most cases. P-value < 0.05 and fold change > 2.0 were used to determine differentially expressed genes.	WBPaper00048989:eat-2(ad465)_upregulated_in-DMSO
	Genes expressed in N2.	Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0.	WBPaper00025141:N2_Expressed_Genes
	Genes upregulated in dcr-1(-/-) adult animals by at least 1.5 fold and P < 0.01, as determined by a multisample t-test and the Benjamini and Hochberg false discovery rate correction.	Statistical t-test: P < 0.05 for rde-4(-/-) and rde-1(-/-) analyses; P < 0.01 for dcr-1(-/-) analysis with a threshold of 1.5-fold misregulation.	WBPaper00029437:dcr-1_upregulated
	Transcripts that showed significantly increased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_upregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly increased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_upregulated_glp-1(e2141)

10 Expression Patterns

• Primary Identifier: Expr2009102
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr6451
• Remark: Strain: BC12142
• Reporter Gene: [R03E9.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TATCCAGAGTTCAATGCAAGTCA] 3' and primer B 5' [CCTGGTAGGGATCGGAAGA] 3'.
• Pattern: Adult Expression: intestine; Nervous System; head neurons; tail neurons; Larval Expression: intestine; Nervous System; head neurons; tail neurons

• Primary Identifier: Expr3245
• Pattern: The abts-4 gene fusion was restricted to the intestine, with the highest expression observed in cells of the posterior- and anterior-most gut region.

• Primary Identifier: Expr3255
• Subcellular Localization: The abts-4 translational fusion was expressed exclusively in the intestine, where it was localized to the basolateral membrane of the gut cells.

• Primary Identifier: Expr1038607
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr2027338
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1023311
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1154891
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Chronogram1883
• Remark: Original chronogram file: chronogram.8.xml
• Reporter Gene: [R03E9.3:gfp] transcriptional fusion.

• Primary Identifier: Chronogram1439
• Remark: Original chronogram file: chronogram.317.xml
• Reporter Gene: [R03E9.3:gfp] transcriptional fusion.

15 GO Annotation

13 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00019844
• Start: 6747296
• End: 6761738
• Strand: -1

15 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 14443

1 Sequence Ontology Term

• Name: gene

4 Strains

• WBStrain00031735
• WBStrain00031734
• WBStrain00002034
• WBStrain00002500

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrX_6761739..6765969
• Length (nt): 4231
• Chromosome Location: X: 6761739-6765969
• Organism: Caenorhabditis elegans