WormMine: Gene WBGene00019982

• WormBase Gene ID: WBGene00019982
• Gene Name: srbc-58
• Sequence Name: R09E12.2
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to be located in membrane. Expressed in neurons.
• Biotype: SO:0001217
• Genetic Position: V :-19.9525±
• Length (nt): 2278

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00019982

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:R09E12.2.1	R09E12.2.1	876	V: 774995-777272

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:R09E12.2	R09E12.2	876	V: 774995-775169

2 RNAi Result

• WBRNAi00051629
• WBRNAi00017653

52 Allele

• WBVar01584344
• gk963591
• gk963553
• gk964259
• gk963850
• gk963027
• gk963889
• gk962552
• gk962551
• WBVar01970640
• gk963833
• WBVar01609807
• WBVar01609806
• WBVar00201898
• WBVar00201897
• WBVar00201899
• WBVar00201900
• WBVar00201901
• tm3893
• WBVar02076438
• WBVar01985229
• WBVar02031607
• WBVar00580325
• WBVar00580326
• WBVar00580328
• WBVar00580329
• WBVar01689316
• WBVar01689315
• WBVar01689317
• WBVar02082713

1 Chromosome

• WormBase ID: V
• Organism: Caenorhabditis elegans
• Length (nt): 20924180

1 Chromosome Location

• Feature . Primary Identifier: WBGene00019982
• Start: 774995
• End: 777272
• Strand: 1

3 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrV_777273..777599
• Length (nt): 327
• Chromosome Location: V: 777273-777599
• Organism: Caenorhabditis elegans

22 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Transcripts that showed significantly increased expression in ogt-1(ok1474) neuronal cells isolated by FACs comparing to in FACs isolated neuronal cells from wild type.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066485:ogt-1(ok1474)_upregulated_neuron
	Transcripts that showed significantly decreased expression in strain GC1459 containing daf-18(ok480) comparing to control strain GC1171.	edgeR, p-value < 0.05, fold change > 2.	WBPaper00061699:daf-18(ok480)_downregulated
Heat shock: 34C 30min.	Transcripts that showed significantly increased expression in L2 larva stage C. elegans animals after incubated in a 34C water bath for 30min.	DESeq2 v 1.18.1, fold change > 2, FDR < 0.01.	WBPaper00058955:heatshock_upregulated_CE
	Transcripts of coding genes that showed significantly increased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_enriched_coding-RNA
	Transcripts that showed significantly increased expression in set-2(tm1630) animals at embryo stage, comparing to in N2 animals.	DESeq2 (v2.1.8.3) was used to determine DE genes and to generate principal component and scatter plots. DE genes with FDR < 0.05 were analysed using g:Profiler with Bonferroni correction.	WBPaper00060014:set-2(tm1630)_upregulated
	Transcripts that showed significantly increased expression in set-2(zr2012) animals at embryo stage, comparing to in N2 animals.	DESeq2 (v2.1.8.3) was used to determine DE genes and to generate principal component and scatter plots. DE genes with FDR < 0.05 were analysed using g:Profiler with Bonferroni correction.	WBPaper00060014:set-2(zr2012)_upregulated
Temprature shift to 28C for 48 hours.	Transcripts that showed significantly increased expression after animals were exposed to 28C temperature for 48 hours.	Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control.	WBPaper00061341:28C_48h_upregulated
	Transcripts that showed significantly increased expression in daf-2(e1370) neurons comparing to in N2 neurons at day 8adult stage.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00066978:daf-2(e1370)_upregulated_neuron
	Transcripts that showed significantly increased expression in daf-16(mu86);daf-2(e1370) neurons comparing to in daf-2(e1370) neurons at day 8adult stage.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00066978:daf-16(mu86)_upregulated_neuron
	Transcripts that showed significantly decreased expression in whole animal day 1 N2 adults comparing to in whole animal day 8 N2 adults.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00066978:Day1Adult_vs_Day8Adult_downregulated_neuron
Bacteria infection: Serratia marcescens	Genes with increased expression after 24 hours of infection by S.marcescens Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:S.marcescens_24hr_upregulated_RNAseq
control(maintained under normal lab light (mostly dark, in incubators).) vs EtBr-exposed(maintained under normal lab light (mostly dark, in incubators) and exposed to EtBr (5ug/mL in agar).) at just prior to the second UVC dose (24h).	Genes differentially expressed in control vs under EtBr treatment without UVC exposure, at the -25h timepoint.	Transcripts were defined as fold-change >1.2, p < 0.05 based on Rosetta Resolver analysis for all pairwise treatment comparisons. The fold-change refers to the second intensity over the first.	WBPaper00041939:control_vs_EtBr-exposed_24h
	Genes from eat-2(ad465) animals with significantly increased expression after 72 hours of treatment on growth media with 10uM rapamycin in 2% DMSO.	Analysis of gene expression data was carried out with the Affymetrix Transcriptome Analysis Console. Data preprocessing (using RMA normalization) and QC metrics were performed using Affymetrix Expression Console TM and manually inspected afterwards. Expression analysis was carried out for each two pairwise conditions. FDR statistical correction for multiple testing resulted in a slightly lower number of DEGs in most cases. P-value < 0.05 and fold change > 2.0 were used to determine differentially expressed genes.	WBPaper00048989:eat-2(ad465)_rapamycin_upregulated
	Transcripts with promoter regions binding DREAM protein complex, according to ChIP-seq of E2F-DP (DPL-1 and EFL-1) and MuvB (LIN-9, LIN-37, LIN-52, and LIN-54) of N2 late embryo.	N.A.	WBPaper00053289:DREAM-target
Bacteria infection: Erwinia carotovora	Genes up-regulated in animals infected with Erwinia carotovora compared to the E. coli OP50 control after 24h of infection.	MAANOVA and BRB-Array-Tools.	WBPaper00030985:Erwinia_carotovora_upregulated
	Coexpression clique No. 211, srj-42-srw-113, on the genome-wide coexpression clique map for the nematode GPL200 platform.	All available microarray datasets for the GPL200 platform (Affymetrix C. elegans Genome Array) were obtained from the GEO repository. This included 2243 individual microarray experiments. These were normalized against each other with the software RMAexpress (Bolstad, 2014). Based on these normalized values, Pearsons correlation coefficients were obtained for each probe-probe pair of the 22,620 probes represented on this array type. The resulting list of correlation coefficients was then ranked to generate the ranked coexpression database with information on each probe represented on the GPL200 platform.	WBPaper00061527:srj-42-srw-113
	Transcripts that showed significantly decreased expression in adr-1(tm668) comparing to in N2.	DESeq2, p-value < 0.05 and a fold enrichment log2fold > 0.5.	WBPaper00055226:adr-1(tm668)_downregulated
	Transcripts that showed significantly decreased expression in hlh-26(ok1453) animals exposed to E. faecium for 8 hours, comparing to N2 animals exposed to E. faecium for 8 hours.	Fold change > 2.	WBPaper00062585:hlh-26(ok1453)_downregulated_E.faecium
	Single-cell RNA-Seq cell group 63_0 expressed in neuron.	scVI 0.6.0	WBPaper00065841:63_0

6 Expression Patterns

• Primary Identifier: Expr2034437
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr6489
• Remark: Also expressed in (comments from author) : No comments. Strain: BC16165
• Reporter Gene: [srbc-58::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGGCCCAACTATTGGAAACT] 3' and primer B 5' [AGCTTCCAGTCGAATGAACAA] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; intestine; anal depressor muscle; rectal epithelium; Reproductive System; vulva other; spermatheca; gonad sheath cells; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; anal depressor muscle; rectal epithelium; Reproductive System; developing gonad; developing vulva; developing spermatheca; gonad sheath cells; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons

• Primary Identifier: Expr14028
• Pattern: Bright expression in many tissues (neurons, pharynx, muscle, hypodermis, vulva, gonad, seam cells)

• Primary Identifier: Expr1155301
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2016205
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1010790
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00019982
• Start: 774995
• End: 777272
• Strand: 1

5 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 2278

1 Sequence Ontology Term

• Name: gene

2 Strains

• WBStrain00033240
• WBStrain00003734

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrV_774776..774994
• Length (nt): 219
• Chromosome Location: V: 774776-774994
• Organism: Caenorhabditis elegans