WormMine: Gene WBGene00020195

• WormBase Gene ID: WBGene00020195
• Gene Name: T03G6.3
• Sequence Name: T03G6.3
• Brief Description: T03G6.3 encodes a protein homologous to human ENPP6 (nucleotide pyrophosphatase/phosphodiesterase 6); T03G6.3 fusion proteins are expressed in body wall and vulval muscles and localize dynamically to the I-bands of bodywall muscle sarcomeres; T03G6.3 activity is required for wild-type levels of PGL-1::GFP in P granules of F1 embryos.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to be involved in lipid catabolic process. Located in I band and striated muscle dense body. Expressed in vulval muscle. Is an ortholog of human ENPP6 (ectonucleotide pyrophosphatase/phosphodiesterase 6).
• Biotype: SO:0001217
• Genetic Position: :±
• Length (nt): 4901

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00020195

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:T03G6.3.1	T03G6.3.1	1807	X: 2610826-2615726

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:T03G6.3	T03G6.3	1398	X: 2611235-2611579

3 RNAi Result

• WBRNAi00052310
• WBRNAi00018093
• WBRNAi00035108

42 Allele

• gk963725
• gk962926
• WBVar00076316
• WBVar00076317
• WBVar00076318
• WBVar00076319
• WBVar01979819
• WBVar02026815
• WBVar01654812
• h13470
• gk954541
• gk638401
• gk473871
• gk761282
• gk885116
• gk727616
• gk668600
• gk687747
• gk763442
• gk890307
• gk428911
• gk707440
• gk424702
• gk749525
• gk396048
• gk778826
• gk605956
• gk672717
• tm8742
• tm5773

1 Chromosome

• WormBase ID: X
• Organism: Caenorhabditis elegans
• Length (nt): 17718942

1 Chromosome Location

• Feature . Primary Identifier: WBGene00020195
• Start: 2610826
• End: 2615726
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrX_2609927..2610825
• Length (nt): 899
• Chromosome Location: X: 2609927-2610825
• Organism: Caenorhabditis elegans

144 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_upregulated
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day5_vs_Day1_downregulated
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Genes that are significantly up regulated in tdp-1(ok803) poly(A) RNA-seq verses in N2.	DESeq v1.14, with cut-off p-value < 0.05 and FDR < 0.1.	WBPaper00046012:tdp-1(ok803)_upregulated
	Transcripts that showed significantly decreased expression at 11-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day11_vs_Day1_downregulated
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
mitochondrial sulfide delivery molecule (mtH2S) AP39	Transcripts that showed significantly increased expression in N2 animals treated with mitochondrial sulfide delivery molecule (mtH2S) AP39 starting from 1-day-post L4 until 11 days post L4.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:mtH2S-AP39-D0-treatment_upregulated_Day11
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_developing
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Genes that showed significantly increased expression in daf-2(e1370);hel-1(gk148684) comparing to in hel-1(gk148684)	To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs.	WBPaper00047131:daf-2(e1370)_upregulated_hel-1(gk148684)-background
	Genes that showed significantly increased expression in daf-2(e1370) comparing to in N2.	To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs.	WBPaper00047131:daf-2(e1370)_upregulated_N2-background
	Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_downregulated
	Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in control animals.	NOIseq(v2.34.0), fold change > = 1.5, Differentially expressed genes (DEGs) were defined as having a probability of differentialexpression > 95%.	WBPaper00064727:daf-2(e1370)_upregulated
	Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals.	Sleuth	WBPaper00051558:aging_regulated
	Transcripts that showed significantly decreased expression in Day 5 (5-days post-L4) vs. Day 0 (L4 larva) of adulthood N2 animals.	Differential expression for both small RNA- and mRNA-seq data was tested using DESeq2; P-values were adjusted for multiple testing by Benjamini-Hochberg method.	WBPaper00053318:Aging_downregulated_mRNA_N2
	Transcripts that showed significantly decreased expression in mir-71(n4115) comparing to in N2 at 4-days post L4 adult hermaphrodite.	Differential expression for both small RNA- and mRNA-seq data was tested using DESeq2; P-values were adjusted for multiple testing by Benjamini-Hochberg method.	WBPaper00053318:mir-71(n4115)_downregulated_mRNA
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Expression Pattern Group C, enriched for genes involved in metabolic processes.	The significance (P 0.0001) of the relative age (time) was used to determine if a gene was differentially expressed between the three age (time) groups. The effect of this factor explaining gene expression differences was used to determine if the expression went up or down during the two age/time periods (t1 - t2 and t2 -t3). Authors used a permutation approach to determine the thresholds for the different mapping strategies. For each of the used models for eQTL mapping, authors used 23,000 permutations. For each permutation, authors randomly picked a spot; each spot could only be picked once. The gene expression and relative lifespan values were than randomly distributed over the RILs (and time points) and used for mapping. In this way, authors obtained a threshold for each of the explaining factors. For the single time points, authors used a FDR of 0.01 to adjust for multiple testing. The genome-wide threshold for this FDR is -log10 P = 3.8 for each of the three time points. For the combined models (t1 to t2 and t2 to t3), authors used a genome-wide threshold of -log10 P = 4, which resembles an FDR of 0.006, 0.001, and 0.006 for marker, age, and the interaction between marker and age, respectively. To determine the threshold for the single gene examples, authors used 1000 permutations as in the genome-wide threshold. The difference is that they use the gene under study in all of the permutations. The P-values for the gene specific thresholds were determined at FDR = 0.05.	WBPaper00036286:Pattern_C
	Transcripts depleted in purified oocyte P bodies comparing to in the whole animal.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_WholeAnimal_depleted
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome
Temprature shift to 28C for 48 hours.	Transcripts that showed significantly decreased expression after animals were exposed to 28C temperature for 48 hours.	Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control.	WBPaper00061341:28C_48h_downregulated
	Transcripts that showed significantly increased expression in animals with germline-specific inx-14(RNAi) comparing to in aniamls fed with control vector, both exposed to PA14 infection.	DESeq2. Differentially-expressed genes (DEG) were identified based on two criteria: FDR (False discovery rateusing Benjamini-Hochberg adjusted p-values) < 0.01 and absolute value of log2(Fold Change) > 1.	WBPaper00066146:germline-inx-14(RNAi)_upregulated_PA14

8 Expression Patterns

• Primary Identifier: Expr6582
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC11369
• Reporter Gene: [T03G6.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGTTCCGCAATCAGATTCAT] 3' and primer B 5' [TGGAAATGAGCAGATAAATGGTAA] 3'.
• Pattern: Adult Expression: body wall muscle; Larval Expression: body wall muscle

• Primary Identifier: Expr1019399
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr9416
• Pattern: Adult Expression: body wall muscle. Larval Expression: body wall muscle
• Subcellular Localization: Sub-cellular localization within the body wall muscle: Sarcoplasmic reticulum (SR)-like

• Primary Identifier: Expr13612
• Remark: Strain UL2448
• Pattern: The gene T03G6.3, chosen based on data from the C. elegans Expression Pattern Consortium, gave GFP expression in bodywall muscle cells of embryos at the three-fold stage of elongation and continued expression within these cells through all larval stages into adulthood, with further expression in the vulval muscles. Within embryos there was not any discernable subcellular localisation of the fluorescence but from the larval stages onwards, the fusion protein localised to distinct subcellular structures within the bodywall muscles. The distribution changed at different focal planes of the muscle, puncta being visible upon the outer regions of the cell whilst deeper within the cell the distribution appeared more uniform, interrupted with irregular areas without fluorescence. The arrangement of the puncta was consistent with the T03G6.3::GFP being localised to dense bodies. The puncta sometimes appeared to be linked with slightly thinner lines acting as connections suggesting the protein was localised all along the centre of the I-bands, but enriched in the dense bodies. There did not seem to be any fusion protein in the nucleus. The distribution of the fusion protein appeared uniform within the vulval muscles. Fluorescence in all stages was very faint in both the integrated lines obtained and all three non-integrated lines. Co-localisation experiments were performed for T03G6.3 and C46G7.2 fusion proteins to confirm the localisation sites within the sarcomere. T03G6.3 localises to the centre of the I-bands and the presence in puncta suggests that it is enriched in the dense bodies.

• Primary Identifier: Expr2024008
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1038785
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr1155946
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2005792
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

7 GO Annotation

6 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00020195
• Start: 2610826
• End: 2615726
• Strand: -1

7 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 4901

1 Sequence Ontology Term

• Name: gene

1 Strains

• WBStrain00037632

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrX_2615727..2618447
• Length (nt): 2721
• Chromosome Location: X: 2615727-2618447
• Organism: Caenorhabditis elegans