WormMine: Gene WBGene00019760

• WormBase Gene ID: WBGene00019760
• Gene Name: calu-1
• Sequence Name: M03F4.7
• Organism: Caenorhabditis elegans
• Automated Description: Enables calcium ion binding activity. Involved in cuticle development. Located in endoplasmic reticulum. Expressed in AIAL; AIAR; and tail. Human ortholog(s) of this gene implicated in colorectal carcinoma and proliferative diabetic retinopathy. Is an ortholog of human CALU (calumenin).
• Biotype: SO:0001217
• Genetic Position: X :-6.19941 ±0.000507
• Length (nt): 1385

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00019760

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:M03F4.7b.1	M03F4.7b.1	1279	X: 4969529-4970913
Transcript:M03F4.7a.1	M03F4.7a.1	1220	X: 4969534-4970911

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:M03F4.7b	M03F4.7b	276	X: 4970565-4970747
CDS:M03F4.7a	M03F4.7a	945	X: 4969793-4969993

16 RNAi Result

• WBRNAi00034410
• WBRNAi00070578
• WBRNAi00050880
• WBRNAi00009003
• WBRNAi00025987
• WBRNAi00066803
• WBRNAi00080514
• WBRNAi00078831
• WBRNAi00113744
• WBRNAi00078829
• WBRNAi00078828
• WBRNAi00078830
• WBRNAi00070576
• WBRNAi00070577
• WBRNAi00113748
• WBRNAi00090683

20 Allele

• gk964260
• WBVar01549542
• gk951150
• tm1783
• gk279402
• gk926736
• gk513445
• gk404914
• gk782695
• gk443063
• gk431993
• gk484726
• gk848571
• gk551357
• gk848572
• gk720980
• WBVar01819752
• gk839072
• gk612686
• gk907650

1 Chromosome

• WormBase ID: X
• Organism: Caenorhabditis elegans
• Length (nt): 17718942

1 Chromosome Location

• Feature . Primary Identifier: WBGene00019760
• Start: 4969529
• End: 4970913
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrX_4969329..4969528
• Length (nt): 200
• Chromosome Location: X: 4969329-4969528
• Organism: Caenorhabditis elegans

250 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	oocyte proteins identified by two or more unique peptides during proteomics study.	In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide.	WBPaper00038289:oocyte_protein
	Genes with expression altered >= 3-fold in dpy-10(e128) mutants.	Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)).	WBPaper00035873:dpy-10_regulated
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_NoFood
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin-Allantoin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Psora-Allantoin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Metformin_upregulated
Heat shock: 35C for 1 hour.	Transcripts that showed significantly increased expression immediately after 1-day post L4 adult hermaphrodite endu-2(tm4977) animals were exposed to 35C for 1 hour.	The DESeq2 (GalaxyVersion 2.11.40.6 + galaxy1) was used to determine differentiallyexpressed features from count tables of differential transcript abundances. log2FC > 1, FDR < 0.01.	WBPaper00065749:Heat-Shock_upregulated_endu-2(tm4977)
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day5_vs_Day1_downregulated
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Genes up regulated in alg-1(gk214) comparing to in N2.	Differential expression was assessed using an empirical Bayes statistics using the eBayes function.	WBPaper00040823:alg-1(gk214)_upregulated
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_daf-16(mu86);glp-1(e2141)
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Transcripts expressed in vulva.	FPKM >= 1.	WBPaper00064122:vulva_transcriptome
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Transcripts that showed significantly increased expression in mrg-1(qa6200) comparing to in control animals in primordial germ cells (PGCs) at L1 larva stage.	DESeq2(v1.32.0), FDR < 0.05.	WBPaper00064315:mrg-1(qa6200)_upregulated_PGCs
Bacteria infection: Staphylococcus aureus	Transcripts that showed significantly decreased expression in animals experimentally colonised by a wild microbiota community and infected by the widespread animal pathogen, Staphylococcus aureus, comparing to animals not colonized by microbiota and not infected by pathogen.	DeSeq2 (v. 1.42.0), Wald analyses testing against a null hypothesis of < |1.5|-fold change in gene expression between treatments (BenjaminiHochberg adjusted false detection rate of p <= 0.05.	WBPaper00067479:Microbiota-Pathogen_vs_control_downregulated

13 Expression Patterns

• Primary Identifier: Expr2009710
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr6416
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC12762
• Reporter Gene: [M03F4.7::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCGATTCGAACTCGGTTATATCTT] 3' and primer B 5' [AGAGAAGAACCTTGATGTCCAGA] 3'.
• Pattern: Adult Expression: pharynx; intestine; rectal epithelium; hypodermis; unidentified cells in tail ; Larval Expression: pharynx; intestine; rectal epithelium; Reproductive System; developing vulva; hypodermis; unidentified cells in tail

• Primary Identifier: Expr6417
• Remark: Strain: BC12836
• Reporter Gene: [M03F4.7::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCGATTCGAACTCGGTTATATCTT] 3' and primer B 5' [AGAGAAGAACCTTGATGTCCAGA] 3'.
• Pattern: Adult Expression: pharynx; body wall muscle; hypodermis; Larval Expression: pharynx; body wall muscle; hypodermis

• Primary Identifier: Expr8788
• Remark: Picture: Fig. 2.
• Pattern: calu-1 is mainly expressed in pharynx, intestine, body wall muscle, and hypodermis. calu-1 is predominantly expressed in muscle cell nuclei of L1 larvae. The same expression of calu-1 was observed in males.

• Primary Identifier: Expr9551
• Pattern: Adult Expression: pharynx; body wall muscle; hypodermis. Larval Expression: pharynx; body wall muscle; hypodermis
• Subcellular Localization: Sub-cellular localization within the body wall muscle: Endoplasmic reticulum (ER) +/- Other

• Primary Identifier: Expr16449
• Pattern: Both transcriptional and translational reporter analysis revealed that calu-1 is strongly expressed in body-wall muscle and AIA interneurons at the dauer stage.

• Primary Identifier: Expr1038546
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Chronogram831
• Remark: Original chronogram file: chronogram.1874.xml
• Reporter Gene: [M03F4.7:gfp] transcriptional fusion.

• Primary Identifier: Expr2027949
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1154573
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr16450
• Pattern: RT-PCR experiments showed that calu-1 mRNA is present in the dauer stage as well as at all reproductive larval and adult stages.

• Primary Identifier: Chronogram1501
• Remark: Original chronogram file: chronogram.375.xml
• Reporter Gene: [M03F4.7:gfp] transcriptional fusion.

• Primary Identifier: Expr1027730
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

7 GO Annotation

18 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00019760
• Start: 4969529
• End: 4970913
• Strand: -1

7 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 1385

1 Sequence Ontology Term

• Name: gene

1 Strains

• WBStrain00001695

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrX_4970914..4971511
• Length (nt): 598
• Chromosome Location: X: 4970914-4971511
• Organism: Caenorhabditis elegans