WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00021800 Gene Name  nduf-9
Sequence Name  ? Y53G8AL.2 Organism  Caenorhabditis elegans
Automated Description  Predicted to be involved in mitochondrial respiratory chain complex I assembly and ubiquinone-6 biosynthetic process. Predicted to be located in mitochondrion. Predicted to be part of respiratory chain complex I. Expressed in head and tail. Human ortholog(s) of this gene implicated in nuclear type mitochondrial complex I deficiency 26. Is an ortholog of human NDUFA9 (NADH:ubiquinone oxidoreductase subunit A9). Biotype  SO:0001217
Genetic Position  Length (nt)  ? 6859
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00021800

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:Y53G8AL.2.1 Y53G8AL.2.1 1445   III: 3241717-3248575
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:Y53G8AL.2 Y53G8AL.2 1296   III: 3241864-3242115

18 RNAi Result

WormBase ID
WBRNAi00095799
WBRNAi00009380
WBRNAi00009381
WBRNAi00078614
WBRNAi00078615
WBRNAi00057303
WBRNAi00090943
WBRNAi00033301
WBRNAi00071387
WBRNAi00078594
WBRNAi00078593
WBRNAi00026819
WBRNAi00026820
WBRNAi00108671
WBRNAi00108596
WBRNAi00108725
WBRNAi00108703
WBRNAi00108714

130 Allele

Public Name
gk962532
gk964281
WBVar01261521
WBVar01261526
WBVar01261523
WBVar01261531
WBVar01261516
WBVar01261514
WBVar01261519
WBVar00247565
WBVar00247567
WBVar01656096
WBVar01656095
WBVar01938643
WBVar01330079
WBVar01330078
WBVar01330081
WBVar01330089
WBVar01330097
WBVar01330098
WBVar01330096
WBVar01330091
WBVar01330092
WBVar01330090
WBVar02077249
WBVar02076779
WBVar01444865
WBVar01444868
WBVar01444866
WBVar01983867

1 Chromosome

WormBase ID Organism Length (nt)
III Caenorhabditis elegans 13783801  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00021800 3241717 3248575 -1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrIII_3241376..3241716   341 III: 3241376-3241716 Caenorhabditis elegans

114 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  oocyte proteins identified by two or more unique peptides during proteomics study. In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide. WBPaper00038289:oocyte_protein
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
  mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis. Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05. WBPaper00045420:fertilization_downregulated_transcript
Osmotic stress Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:OsmoticStress_regulated_Food
  Genes that were downregulated in lin-15B(n744). For each gene in each microarray hybridization experiment, the ratio of RNA levels from the two samples was transformed into a log2 value and the mean log2 ratio was calculated. The log2 ratios were normalized by print-tip Loess normalization (Dudoit and Yang, 2002). All genes with a false discovery rate of <= 5% (q <= 0.05) (Storey and Tibshirani, 2003) and a mean fold-change ratio of >= 1.5 were selected for further analysis. WBPaper00038168:lin-15B(n744)_downregulated
  Proteins interacting with NHR-49-GFP according to co-IP and LC-MS. N.A. WBPaper00064071:NHR-49_interacting
  Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:GABAergic-neuron_expressed
  Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:hypodermis_expressed
  Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:intestine_expressed
  Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:NMDA-neuron_expressed
  Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
  Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
Bacteria infection: Bacillus thuringiensis mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq. Cuffdiff, ajusted p-value < 0.01. WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq. Cuffdiff, ajusted p-value < 0.01. WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq. Cuffdiff, ajusted p-value < 0.01. WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq. Cuffdiff, ajusted p-value < 0.01. WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
  Maternal class (M): genes that are called present in at least one of the three PC6 replicates. A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. [cgc5767]:expression_class_M
  Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic. A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. [cgc5767]:expression_class_SM
  Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals. Sleuth WBPaper00051558:aging_regulated
  Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy. Cufflinks WBPaper00065120:body-muscle-transcriptome
  Proteins that showed significantly decreased expression after 1-day-old wild type adults were exposed to cisplatin (300ug per mL) for 6 hours. The differential expression analysis was performed in R. Differentially expressed proteins were identified by using a two-sided t-test on log-transformed data. WBPaper00065373:Cisplatin_downregulated_WT
  Proteins that showed significantly decreased expression in 1-day-old sek-1(km4) adults comparing to in wild type animals, both with 6 hours of cisplatin treatment. The differential expression analysis was performed in R. Differentially expressed proteins were identified by using a two-sided t-test on log-transformed data. WBPaper00065373:sek-1(km4)_downregulated_cisplatin
  Transcripts that showed significantly increased expression in nuo-6(qm200) comparing to in N2. Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1. WBPaper00053810:nuo-6(qm200)_upregulated
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:excretory-cell_L2-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:hypodermis_L3-L4-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:intestine_L2-larva_expressed
  Transcripts detected in germline isolated from day-1 adult hermaphrodite animals. All three experiments have CPM >= 1. WBPaper00067147:germline_expressed
  Proteins interacting with HA-PPM-1.D. N.A. WBPaper00062498:PPM-1.D_interacting
  Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis. To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq. WBPaper00045521:Gender_Neutral
  Transcripts that showed altered expression from P0 to F2 generation animals after N2 parental generation were treated with antimycin, but not in damt-1(gk961032) P0 to F2 animals after the parenal generaton were treated with antimycin. N.A. WBPaper00055862:antimycin_damt-1(gk961032)_regulated

6 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr2026106 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr2007864 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1013048 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr1039562 Tiling arrays expression graphs  
Also expressed in (comments from author) : No comments. Strain: BC15444 [Y53G8AL.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCCCTCCCCACACTCTCT] 3' and primer B 5' [TGATAGGATGGCTGAAATTAGGA] 3'. Expr7036 Adult Expression: pharynx; intestine; anal depressor muscle; Reproductive System; vulval muscle; vulva other; body wall muscle; hypodermis; excretory cell; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; intestine; anal depressor muscle; Reproductive System; distal tip cell; developing vulva; body wall muscle; hypodermis; excretory cell; unidentified cells in head; unidentified cells in tail ;  
    Expr1160739 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  

6 GO Annotation

Annotation Extension Qualifier
  enables
  involved_in
  involved_in
  located_in
  located_in
  part_of

4 Homologues

Type
least diverged orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00021800 3241717 3248575 -1

6 Ontology Annotations

Annotation Extension Qualifier
  enables
  involved_in
  involved_in
  located_in
  located_in
  part_of

0 Regulates Expr Cluster

1 Sequence

Length
6859

1 Sequence Ontology Term

Identifier Name Description
gene  

1 Strains

WormBase ID
WBStrain00003494

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrIII_3248576..3249150   575 III: 3248576-3249150 Caenorhabditis elegans