WormMine: Gene WBGene00019900

• WormBase Gene ID: WBGene00019900
• Gene Name: vdac-1
• Sequence Name: R05G6.7
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable voltage-gated monoatomic anion channel activity. Involved in mitochondrion organization. Acts upstream of or within with a positive effect on olfactory behavior. Located in mitochondrion. Expressed in AWCL and AWCR. Human ortholog(s) of this gene implicated in Parkinson's disease; Parkinsonism; and prostate cancer. Is an ortholog of human VDAC1 (voltage dependent anion channel 1) and VDAC2 (voltage dependent anion channel 2).
• Biotype: SO:0001217
• Genetic Position: IV :3.34071±
• Length (nt): 1465

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00019900

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:R05G6.7.1	R05G6.7.1	1022	IV: 7506427-7507891

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:R05G6.7	R05G6.7	852	IV: 7506594-7506812

5 RNAi Result

• WBRNAi00051327
• WBRNAi00034629
• WBRNAi00017468
• WBRNAi00116401
• WBRNAi00116348

28 Allele

• gk964278
• gk964500
• gk963722
• gk963417
• gk963416
• WBVar00245809
• WBVar00245808
• tm3491
• WBVar00190688
• gk205627
• gk205628
• gk205626
• gk881947
• gk535648
• gk667185
• gk716962
• gk659250
• gk916472
• gk915777
• gk537593
• gk804315
• gk857527
• gk821230
• gk746948
• gk955546
• gk958978
• frm101
• WBVar01966589

1 Chromosome

• WormBase ID: IV
• Organism: Caenorhabditis elegans
• Length (nt): 17493829

1 Chromosome Location

• Feature . Primary Identifier: WBGene00019900
• Start: 7506427
• End: 7507891
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

178 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	oocyte proteins identified by two or more unique peptides during proteomics study.	In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide.	WBPaper00038289:oocyte_protein
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_NoFood
	Genes that were downregulated in lin-15B(n744).	For each gene in each microarray hybridization experiment, the ratio of RNA levels from the two samples was transformed into a log2 value and the mean log2 ratio was calculated. The log2 ratios were normalized by print-tip Loess normalization (Dudoit and Yang, 2002). All genes with a false discovery rate of <= 5% (q <= 0.05) (Storey and Tibshirani, 2003) and a mean fold-change ratio of >= 1.5 were selected for further analysis.	WBPaper00038168:lin-15B(n744)_downregulated
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Genes significantly enriched in NSM neurons (isolated by FACS) versus the reference, according to RNAseq analysis towards total RNA.	Gene expression quantification and differential expression was analyzed using cufflinks v2.2.1. Enriched contains only genes significantly enriched (differentially expressed >= 2.4 fold in total RNA or >= 3.2 fold in DSN treated total RNA) in the NSM neurons versus the reference.	WBPaper00045974:NSM_enriched_totalRNA_RNAseq
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals.	Sleuth	WBPaper00051558:aging_regulated
Transgeneration hypoxia treatment.	Transcripts that are significantly upregulated in F1 animals after P0 parents were exposed to 0.1% oxygen for 16 hours at L4 larva stage.	For calling the significant differentially expressed genes (DEGs),the false discovery rate (FDR) after multiple testing correction was set as 0.05 and analyzed in edgeR.	WBPaper00064871:hypoxia_upregulated_F1
	Transcripts that showed significantly decreased expression in N2 day 10 adults comparing to in N2 day 1 adult animals according to Illumina RNASeq.	DESeq fold change > 2, FDR < 0.05.	WBPaper00067499:Day10_vs_Day1_downregulated_Illumina
	Transcripts that showed significantly decreased expression in N2 day 15 adults comparing to in N2 day 1 adult animals according to Illumina RNASeq.	DESeq fold change > 2, FDR < 0.05.	WBPaper00067499:Day15_vs_Day1_downregulated_Illumina
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome
Temprature shift to 28C for 24 hours.	Transcripts that showed significantly decreased expression after animals were exposed to 28C temperature for 24 hours.	Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control.	WBPaper00061341:28C_24h_downregulated
Temprature shift to 28C for 48 hours.	Transcripts that showed significantly decreased expression after animals were exposed to 28C temperature for 48 hours.	Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control.	WBPaper00061341:28C_48h_downregulated

11 Expression Patterns

• Primary Identifier: Expr4392
• Pattern: Levels of VDAC protein level held more-or-less constant as animals aged (4 to 12 days old adults). In addition, protein levels held steady with aging when the input was 150 animals per sample rather than a fixed amount of total protein.

• Primary Identifier: Expr6465
• Remark: Also expressed in (comments from author) : No comments. Strain: BC14325
• Reporter Gene: [R05G6.7::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTGCCCTTTCTTTCGCATAG] 3' and primer B 5' [TGGTGGGGCGATTTTCTA] 3'.
• Pattern: Adult Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; body wall muscle; head mesodermal cell; hypodermis; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; tail neurons; Larval Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; body wall muscle; head mesodermal cell; hypodermis; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; tail neurons

• Primary Identifier: Expr12431
• Pattern: GFP expression induced by the vdac-1 promoter was observed in various tissues, including head neurons. This GFP expression merged with AWC-specific expression of mCherry, suggesting that vdac-1 is indeed expressed in AWC olfactory neurons.

• Primary Identifier: Expr2036101
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1038635
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr1155020
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr1012205
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr12432
• Subcellular Localization: VDAC-1 was localized at sensory cilia and cell bodies of AWC. Punctuated localization of VDAC-1::GFP was also observed in AWC axons. VDAC-1::GFP was colocalized with the mitochondrial marker Mt-mCherry at dendrites and axons of AWC. VDAC-1 is localized on the mitochondria of AWC.

• Primary Identifier: Expr2017965
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Chronogram1295
• Remark: Original chronogram file: chronogram.2414.xml
• Reporter Gene: [R05G6.7:gfp] transcriptional fusion.

• Primary Identifier: Expr2020
• Pattern: Expression is seen in all stages from pre-comma-stage until early larval stages, in a number (sometimes only one) of unidentified nuclei.

16 GO Annotation

22 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00019900
• Start: 7506427
• End: 7507891
• Strand: -1

16 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 1465

1 Sequence Ontology Term

• Name: gene

0 Strains

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrIV_7507892..7508366
• Length (nt): 475
• Chromosome Location: IV: 7507892-7508366
• Organism: Caenorhabditis elegans