WormMine: Gene WBGene00021929

• WormBase Gene ID: WBGene00021929
• Gene Name: dcap-1
• Sequence Name: Y55F3AM.12
• Brief Description: dcap-1 encodes an ortholog of budding yeast Dcp1p and human DCP1A(OMIM:607010) and DCP1B (OMIM:609843); DCAP-1 is expressed in diversetissues, including muscle, intestine, neurons, and the reproductivesystem; DCAP-1 is colocalized with CAR-1 to P granules, and with AIN-1and CAR-1 to discrete cytoplasmic foci that resemble P bodies; althoughit is orthologous to mRNA decapping complex subunits, DCAP-1 itselfshows no decapping activity in vitro on either m7GpppG- orm2,2,7GpppG-capped RNAs; however, dcap-1(RNAi) shows weak syntheticlethality with dcap-2(RNAi), suggesting that DCAP-1 and DCAP-2 arepartially redundant in vivo.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable mRNA binding activity. Involved in several processes, including determination of adult lifespan; nematode larval development; and response to stress. Located in P granule and P-body. Expressed in head; motor neurons; neurons; tail; and touch receptor neurons. Is an ortholog of human DCP1A (decapping mRNA 1A) and DCP1B (decapping mRNA 1B).
• Biotype: SO:0001217
• Genetic Position: IV :-22.4137 ±0.043406
• Length (nt): 2271

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00021929

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:Y55F3AM.12.1	Y55F3AM.12.1	1452	IV: 1052524-1054794

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:Y55F3AM.12	Y55F3AM.12	999	IV: 1052969-1053073

5 RNAi Result

• WBRNAi00057523
• WBRNAi00021044
• WBRNAi00021047
• WBRNAi00082157
• WBRNAi00082155

53 Allele

• gk963722
• gk964482
• gk963025
• gk963557
• gk963558
• gk964114
• gk193356
• gk193355
• gk193354
• gk193353
• WBVar00183339
• WBVar00183337
• WBVar00183338
• WBVar00183335
• WBVar00183336
• WBVar00183340
• WBVar00183341
• WBVar01608753
• tm10220
• WBVar01821116
• WBVar01821117
• WBVar01821118
• WBVar01825570
• otn3119
• tm2982
• tm3163
• WBVar01724629
• WBVar01667791
• WBVar01667790
• WBVar01510080

1 Chromosome

• WormBase ID: IV
• Organism: Caenorhabditis elegans
• Length (nt): 17493829

1 Chromosome Location

• Feature . Primary Identifier: WBGene00021929
• Start: 1052524
• End: 1054794
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrIV_1051687..1052523
• Length (nt): 837
• Chromosome Location: IV: 1051687-1052523
• Organism: Caenorhabditis elegans

112 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_NoFood
	Transcripts that showed significantly increased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Metformin_upregulated
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
Bacteria diet: Escherichia coli HB101. Fed for 30 generations.	Transcripts that showed significantly decreased expression after fed by bacteria E. coli HB101 for 30 generations comparing to animals fed by E. coli OP50.	DESeq2 fold change > 2, p-value < 0.01.	WBPaper00061007:HB101_downregulated
Bacteria diet: Sphingomonas aquatilis Yellow. Fed for 30 generations.	Transcripts that showed significantly decreased expression after fed by bacteria Sphingomonas aquatilis (Yellow) for 30 generations comparing to animals fed by E. coli OP50.	DESeq2 fold change > 2, p-value < 0.01.	WBPaper00061007:S.aquatilis_downregulated
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Genes down regulated by mir-243(n4759).	RNAs that changed at least 2-fold with a probability of p > 0.05 in three biological replicates were considered differentially regulated between wild-type and mir-243.	WBPaper00036130:mir-243_down_regulated
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:A-class-motor-neurons_L2-larva_expressed
	Transcripts that showed significantly decreased expression in tetraploid N2 comparing to diploid N2 animals at L4 larva stage.	DESeq2 R package (1.20.0), fold change > 2, and FDR < 0.05.	WBPaper00066110:tetraploid_vs_diploid_downregulated
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:coelomocytes_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:excretory-cell_L2-larva_expressed
	Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066594:ilc-17.1(syb5296)_upregulated
	Transcriptions that showed significantly increased expression in skn-1(RNAi) comparing to empty vector injection into rrf-3(pk1426);daf-2(e1368) animals.	Genes with an absolute fold changeof at least 2 and standard p-values below 0.05 were considered as differentially expressed.	WBPaper00062193:skn-1(RNAi)_upregulated
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
	Proteins interacting with HA-PPM-1.D.	N.A.	WBPaper00062498:PPM-1.D_interacting
	Transcripts that showed significantly decreased expression in the neurons of bcat-1(RNAi) animals at 5-days post L4 adult hermaphrodite stage, comparing to animals injected with empty vector.	DESeq2. FDR < 0.05.	WBPaper00060459:bcat-1(RNAi)_downregulated
	Transcripts that showed significantly decreased expression in nhl-2(ok818) comparing to in N2 at 25C.	EdgeR, FDR < 0.05, fold change < 0.5.	WBPaper00055971:nhl-2(ok818)_25C_upregulated
	Transcripts that showed decreased expression in hlh-11(ko1) knockout strain comparing to in wild type background.	DESeq2, FDR < 0.05	WBPaper00060683:hlh-11(ko1)_downregulated
Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours.	Transcripts that showed significantly decreased expression in hpx-2(dg047) after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50.	Cuffcompare and Cuffdiff	WBPaper00056090:E.faecalis_downregulated_hpx-2(dg047)
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:coelomocytes_L1-larva_expressed
	Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014.	N.A.	WBPaper00026929:sir-2.1_overexpression_regulated
	Transcripts of coding genes that showed significantly increased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_enriched_coding-RNA

13 Expression Patterns

• Primary Identifier: Chronogram1212
• Remark: Original chronogram file: chronogram.2335.xml
• Reporter Gene: [Y55F3AM.12:gfp] transcriptional fusion.

• Primary Identifier: Expr11898
• Subcellular Localization: Worms expressing the Pdcap-1::gfp reporter displayed a smooth and diffused fluorescent signal throughout the cytoplasm of most cells.

• Primary Identifier: Expr11899
• Subcellular Localization: Worms bearing the dcap-1::gfp fusion showed an ubiquitous expression pattern with occasional cytoplasmic puncta, varying among the worms.

• Primary Identifier: Expr7062
• Remark: Strain: BC13983
• Reporter Gene: [Y55F3AM.12::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GACGCTTTGATTGTTTAGATTTGA] 3' and primer B 5' [CGTCGCTGATACTGGTTCCT] 3'.
• Pattern: Adult Expression: pharynx; intestine; anal depressor muscle; body wall muscle; excretory cell; Nervous System; nerve ring; head neurons; Larval Expression: pharynx; intestine; anal depressor muscle; Reproductive System; developing vulva; body wall muscle; excretory cell; Nervous System; nerve ring; head neurons

• Primary Identifier: Expr8554
• Remark: New Symbol: tia-1. Picture: Fig. 1, Fig S1.
• Subcellular Localization: All P-body and stress granule GFP fusions localized to cytoplasmic foci. Some fusions appeared almost exclusively in foci (DCAP-1 and PATR-1), whereas others were also detected diffusely in the cytoplasm (CGH-1, LSM-1/-3, CCF-1, PAB-1, and TIA-1). DCAP-1, CGH-1, PATR-1, and CCF-1 fusions formed foci in both somatic and germline blastomeres. In contrast, LSM-1 and LSM-3 fusions only localized to foci in somatic blastomeres, and PAB-1 and TIA-1 fusions only localized to foci in germline blastomeres. In contrast, exosome GFP fusions were diffusely distributed in the cytoplasm and nuclei in all blastomeres and did not form distinct foci.

• Primary Identifier: Expr3648
• Subcellular Localization: The punctate cytoplasmic pattern of AIN-1::GFP resembles that of the P bodies. By using an anti-DCAP-2 antibody, DCAP-2 has been localized to cytoplasmic foci in C. elegans embryos that resembled P bodies (Richard Davis, personal communication). DCAP-2 is the mammalian and yeast homolog of subunit Dcp2 of decapping enzymes that localizes at P bodies. Staining using this antibody and an anti-GFP antibody indicated that AIN-1 was colocalized with DCAP-2 in the embryos. AIN-1::GFP was also observed to be colocalized with a FLAG-tagged DCAP-1 protein at cytoplasmic foci in C. elegans larvae. DCAP-1 is a homolog of mammalian and yeast Dcp1 that are also a subunit of decapping enzymes localized at P bodies.

• Primary Identifier: Expr2029039
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr2010802
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1022509
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr9914
• Pattern: DCAP-1::RFP was weakly expressed and homogenously distributed in the cytoplasm at all stages of embryogenesis. After hatching, DCAP-1::RFP also aggregated into granules, especially in the head and tail regions. The number and size of aggregates were gradually increased as the animal grew. Many big DCAP-1::RFP aggregates were formed throughout the body in old adult animals.

• Primary Identifier: Expr1160958
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr1039641
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr14945
• Pattern: We examined functional transgenes of full-length DCAP-1 or CGH-1 expressed under their respective promoters and observed expression in many neurons including TRNs and motor neurons, localizing to cytoplasmic puncta in neuronal cell bodies.

28 GO Annotation

10 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00021929
• Start: 1052524
• End: 1054794
• Strand: -1

28 Ontology Annotations

2 Regulates Expr Cluster

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in dcap-1(tm3163) comparing to in N2 animals on the 9th day of adulthood.	Differential expression analysis was performed by using the limma package of the Bioconductor suite in R. Fold change > 2, FDR < 0.05.	WBPaper00065043:dcap-1(tm3163)_upregulated
	Transcripts that showed significantly decreased expression in dcap-1(tm3163) comparing to in N2 animals on the 9th day of adulthood.	Differential expression analysis was performed by using the limma package of the Bioconductor suite in R. Fold change > 2, FDR < 0.05.	WBPaper00065043:dcap-1(tm3163)_downregulated

1 Sequence

• Length: 2271

1 Sequence Ontology Term

• Name: gene

2 Strains

• WBStrain00036759
• WBStrain00002810

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrIV_1054795..1055022
• Length (nt): 228
• Chromosome Location: IV: 1054795-1055022
• Organism: Caenorhabditis elegans