WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00022673 Gene Name  sahd-1
Sequence Name  ? ZK177.8 Organism  Caenorhabditis elegans
Automated Description  Enables dGTPase activity; deoxynucleoside triphosphate hydrolase activity; and protein homodimerization activity. Involved in dGTP catabolic process. Predicted to be located in nucleus. Expressed in head and tail. Human ortholog(s) of this gene implicated in several diseases, including Aicardi-Goutieres syndrome; Chilblain lupus; and hepatitis B. Is an ortholog of human SAMHD1 (SAM and HD domain containing deoxynucleoside triphosphate triphosphohydrolase 1). Biotype  SO:0001217
Genetic Position  Length (nt)  ? 5924
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00022673

Genomics

8 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:ZK177.8a.2 ZK177.8a.2 2037   II: 5509022-5513792
Transcript:ZK177.8a.1 ZK177.8a.1 2104   II: 5509022-5514945
Transcript:ZK177.8b.1 ZK177.8b.1 1878   II: 5509028-5511208
Transcript:ZK177.8b.2 ZK177.8b.2 1979   II: 5509028-5513019
Transcript:ZK177.8b.3 ZK177.8b.3 1939   II: 5509029-5512046
Transcript:ZK177.8e.1 ZK177.8e.1 1725   II: 5509237-5512040
Transcript:ZK177.8d.1 ZK177.8d.1 1812   II: 5509237-5513061
Transcript:ZK177.8c.1 ZK177.8c.1 1836   II: 5509237-5514892
 

Other

5 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:ZK177.8a ZK177.8a 1764   II: 5509237-5509467
CDS:ZK177.8d ZK177.8d 1812   II: 5509237-5509467
CDS:ZK177.8c ZK177.8c 1836   II: 5509237-5509467
CDS:ZK177.8b ZK177.8b 1662   II: 5509237-5509467
CDS:ZK177.8e ZK177.8e 1725   II: 5509237-5509467

4 RNAi Result

WormBase ID
WBRNAi00059260
WBRNAi00001766
WBRNAi00021902
WBRNAi00038219

76 Allele

Public Name
gk963801
gk963053
h3745
cxTi9104
WBVar01603870
WBVar00248510
WBVar01437821
WBVar01719760
WBVar02073812
WBVar01505031
WBVar01505030
gk143087
gk143084
gk143085
gk143086
gk143080
gk143081
gk143082
gk143083
gk143079
WBVar02040228
WBVar01393671
WBVar01306054
WBVar01306052
WBVar01306053
WBVar01306051
WBVar01306049
WBVar01306047
WBVar01306048
WBVar00172173

1 Chromosome

WormBase ID Organism Length (nt)
II Caenorhabditis elegans 15279421  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00022673 5509022 5514945 -1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

0 Downstream Intergenic Region

150 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:all-neurons_L1-larva_expressed
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  Genes that were upregulated in lin-15B(n744). For each gene in each microarray hybridization experiment, the ratio of RNA levels from the two samples was transformed into a log2 value and the mean log2 ratio was calculated. The log2 ratios were normalized by print-tip Loess normalization (Dudoit and Yang, 2002). All genes with a false discovery rate of <= 5% (q <= 0.05) (Storey and Tibshirani, 2003) and a mean fold-change ratio of >= 1.5 were selected for further analysis. WBPaper00038168:lin-15B(n744)_upregulated
  Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc). DESeq2, fold change >= 2, FDR <= 0.01. WBPaper00056826:SGP_biased
  Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:arcade_intestinal-valve_expressed
  Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:body-muscle_expressed
  Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:GABAergic-neuron_expressed
  Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:intestine_expressed
  Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-1-adult_vs_L4_upregulated_daf-16(mu86);glp-1(e2141)
  Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-1-adult_vs_L4_upregulated_fem-3(q20)
  Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-1-adult_vs_L4_upregulated_glp-1(e2141)
  Transcripts that showed significantly increased expression in day 3 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-3-adult_vs_L4_upregulated_fem-3(q20)
Bacteria infection: Bacillus thuringiensis mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq. Cuffdiff, ajusted p-value < 0.01. WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
  Transcripts that showed significantly decreased expression in hsp-6(mg585) comparing to in N2 at L4 larva stage. EdgeR, fold change > 2, FDR < 0.001. WBPaper00056290:hsp-6(mg585)_downregulated
  Maternal class (M): genes that are called present in at least one of the three PC6 replicates. A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. [cgc5767]:expression_class_M
  Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic. A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. [cgc5767]:expression_class_SM
  Transcripts that showed significantly increased expression in alg-1(gk214), comparing to in N2. DESeq2, Fold change > 1.5. WBPaper00051404:alg-1(gk214)_upregulated
  Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals. Sleuth WBPaper00051558:aging_regulated
  Significantly differentially expressed genes as determined by microarray analysis of wild-type and cde-1 mutant germlines. RNAs that changed at least 2-fold with a probability of p < 0.05 were considered differentially regulated between wildtype and cde-1. WBPaper00035269:cde-1_regulated
Heat Shock: 35C 4 hours at L4 larva stage. Transcripts that showed significantly decreased expression after L4 larva N2 animals were heat stressed at 35C for 4 hours DESeq2 WBPaper00057154:HeatShock_downregulated_mRNA
  Genes down regulated by mir-243(n4759). RNAs that changed at least 2-fold with a probability of p > 0.05 in three biological replicates were considered differentially regulated between wild-type and mir-243. WBPaper00036130:mir-243_down_regulated
  Transcripts that showed significantly increased expression in 10-days post L4 adult hermaphrodite N2 grown at 20C, comparing to in 1-day post L4 adult hermaphrodite N2 animals grown at 20C. CuffDiff, fold change > 2. WBPaper00065096:Day10_vs_Day1_upregulated
Reduced humidity (98% relative humidity). Genes that were down-regulated after one day exposure to reduced humidity (98% relative humidity) according to microarray analysis. Multiple hypothesis testing with the Benjamini-Hochberg correction was applied on calculated p-values. A change in the expression level was considered to be significant if the adjusted p-value was less than 0.001. WBPaper00044578:reduced-humidity_downregulated_microarray
  Transcripts that showed significantly decreased expression in tetraploid N2 comparing to diploid N2 animals at L4 larva stage. DESeq2 R package (1.20.0), fold change > 2, and FDR < 0.05. WBPaper00066110:tetraploid_vs_diploid_downregulated
  Genes that showed oscillating mRNA expression level throughout the 16 hour time courses from L3 larva to young adult. The following three lines of R code were used to perform the classification: increasing <-2*amplitude-PC1 < -1.7; oscillating <-!increasing & (amplitude > 0.55); flat <-!increasing & !oscillating; Note that the amplitude of a sinusoidal wave corresponds to only half the fold change between trough and peak. WBPaper00044736:oscillating_dev_expression
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:coelomocytes_L2-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:dopaminergic-neurons_L3-L4-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:GABAergic-motor-neurons_L2-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 0hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:germline-precursors_blastula-embryo_expressed

11 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr2027011 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
Original chronogram file: chronogram.1425.xml [ZK177.8:gfp] transcriptional fusion. Chronogram414    
    Expr1040019 Tiling arrays expression graphs  
Original chronogram file: chronogram.246.xml [ZK177.8:gfp] transcriptional fusion. Chronogram1313    
Original chronogram file: chronogram.887.xml [ZK177.8:gfp] transcriptional fusion. Chronogram1970    
    Expr2008776 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1028778 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Strain: BC10675 [ZK177.8a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTTATCACAGAATGTTCGGCACT] 3' and primer B 5' [GCTTTGCCAGTTGATATTGC] 3'. Expr7197 Adult Expression: pharynx; stomato-intestinal muscle; Reproductive System; vulval muscle; gonad sheath cells; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ; Larval Expression: pharynx; intestine; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; unidentified cells in head; unidentified cells in tail ;  
    Expr1162688 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
Also expressed in (comments from author) : Unidentified cells in head and tail may be neural. Strain: BC10135 [ZK177.8a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTTATCACAGAATGTTCGGCACT] 3' and primer B 5' [GCTTTGCCAGTTGATATTGC] 3'. Expr7198 Adult Expression: pharynx; intestine; hypodermis; excretory cell; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; intestine; hypodermis; excretory cell; unidentified cells in head; unidentified cells in tail ;  
Strain: BC15426 [ZK177.8b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACCGTATTCCTCATATTAGTGCTC] 3' and primer B 5' [TTGCCAGTTGATATTGCAGC] 3'. Expr7199 Adult Expression: pharynx; intestine; anal depressor muscle; Reproductive System; vulval muscle; gonad sheath cells; body wall muscle; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; Larval Expression: pharynx; intestine; anal depressor muscle; Reproductive System; developing vulva; gonad sheath cells; body wall muscle; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons;  

15 GO Annotation

Annotation Extension Qualifier
  enables
  involved_in
  located_in
  located_in
  located_in
  located_in
  located_in
  enables
  enables
  enables
  enables
  enables
  enables
  involved_in
  involved_in

5 Homologues

Type
least diverged orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00022673 5509022 5514945 -1

15 Ontology Annotations

Annotation Extension Qualifier
  enables
  involved_in
  located_in
  located_in
  located_in
  located_in
  located_in
  enables
  enables
  enables
  enables
  enables
  enables
  involved_in
  involved_in

0 Regulates Expr Cluster

1 Sequence

Length
5924

1 Sequence Ontology Term

Identifier Name Description
gene  

3 Strains

WormBase ID
WBStrain00001464
WBStrain00003484
WBStrain00001188

0 Upstream Intergenic Region