WormMine: Gene WBGene00023526

• WormBase Gene ID: WBGene00023526
• Gene Name: Cbr-upp-1
• Sequence Name: CBG00006
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable uridine phosphorylase activity. Predicted to be involved in nucleoside metabolic process and nucleotide catabolic process. Predicted to be located in cytoplasm. Is an ortholog of C. elegans upp-1. In C. elegans, upp-1 is involved in thymidine metabolic process; uracil catabolic process; and uridine catabolic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG00006.1	CBG00006.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG00006	CBG00006		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly decreased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_downregulated

1 Expression Patterns

• Primary Identifier: Expr1059344
• Remark: CBG00006, GTCCAAATCGACAAGGAGAAGTACATTGAGTACGAGGAGCGCCCGTTCCGTCTCGTCACC, WBGene00023526
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region