WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00023539 Gene Name  Cbr-mab-5
Sequence Name  ? CBG00029 Organism  Caenorhabditis briggsae
Automated Description  Predicted to enable DNA binding activity. Is an ortholog of C. elegans mab-5. In C. elegans, mab-5 is involved in several processes, including neuroblast migration; positive regulation of mesodermal cell fate specification; and regulation of transcription by RNA polymerase II. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG00029a.1 CBG00029a.1   [unknown]
Transcript:CBG00029b.1 CBG00029b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG00029a CBG00029a   [unknown]
CDS:CBG00029b CBG00029b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG00043, AAAGGAGGCGAAGGGCGAGGGCGGAAGCAATGAATCCGATGAGGAATCGAATCAAGACGA, WBGene00023551   Expr1065410 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Cbr-mab-5, AATATTTGACCCGAAAGCGGCGACAGGAAATTTCAGAGACCCTTCATTTGACTGAAAGAC, WBGene00023539   Expr1050451 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  enables

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  enables

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region