WormMine: Gene WBGene00023569

• WormBase Gene ID: WBGene00023569
• Gene Name: Cbr-alh-13
• Sequence Name: CBG00074
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity; glutamate-5-semialdehyde dehydrogenase activity; and kinase activity. Predicted to be involved in proline biosynthetic process. Predicted to be located in cytoplasm. Is an ortholog of C. elegans alh-13.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG00074b.1	CBG00074b.1		[unknown]
Transcript:CBG00074a.1	CBG00074a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG00074a	CBG00074a		[unknown]
CDS:CBG00074b	CBG00074b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly decreased expression in Cbr-htz-1(gu167) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-htz-1(gu167)_downregulated

1 Expression Patterns

• Primary Identifier: Expr1063788
• Remark: Cbr-alh-13, ACTATCTTCATGAGAATCTCAACCCAAGTGAGGTTTACAGAGCATTGGAAGCAACTGGAG, WBGene00023569
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

8 GO Annotation

0 Homologues

0 Locations

8 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region