WormMine: Gene WBGene00023570

• WormBase Gene ID: WBGene00023570
• Gene Name: Cbr-ilc-17.1
• Sequence Name: CBG00075
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable cytokine activity. Predicted to be located in extracellular region. Is an ortholog of C. elegans ilc-17.1. In C. elegans, ilc-17.1 is involved in positive regulation of locomotion and response to oxygen levels.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG00075.1	CBG00075.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG00075	CBG00075		[unknown]

0 RNAi Result

2 Allele

• WBVar00023184
• WBVar00023189

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1066083
• Remark: CBG00075, GTTGTAACACTTTTCGGGAGGCCGTTGAGACTATCTCATTAGCTTGCATTCCAGTAATTC, WBGene00023570
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region