WormMine: Gene WBGene00023583

• WormBase Gene ID: WBGene00023583
• Gene Name: Cbr-zmp-5
• Sequence Name: CBG00098
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable metalloendopeptidase activity and zinc ion binding activity. Predicted to be involved in proteolysis. Predicted to be located in extracellular matrix. Is an ortholog of C. elegans zmp-5.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG00098.1	CBG00098.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG00098	CBG00098		[unknown]

0 RNAi Result

4 Allele

• WBVar00001694
• WBVar00059259
• WBVar00059264
• WBVar00059269

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1066820
• Remark: CBG00098, TCTTATTTCTGGCAGTACTCTCGTCATGGAAAACAACAAAAGTGGCCACAGCTGATTGCA, WBGene00023583
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region