WormMine: Gene WBGene00023607

• WormBase Gene ID: WBGene00023607
• Gene Name: Cbr-lin-2
• Sequence Name: CBG00133
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity and protein tyrosine kinase activity. Is an ortholog of C. elegans lin-2. In C. elegans, lin-2 is involved in several processes, including egg-laying behavior; positive regulation of vulval development; and protein localization to membrane.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG00133a.1	CBG00133a.1		[unknown]
Transcript:CBG00133b.1	CBG00133b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG00133a	CBG00133a		[unknown]
CDS:CBG00133b	CBG00133b		[unknown]

0 RNAi Result

3 Allele

• WBVar00135503
• WBVar00135504
• WBVar00135505

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1064639
• Remark: Cbr-lin-2, TGGAGCTCATGGAGTTGGTCGACGACATATAAAGAACACGCTGATACATAGACATCCAAA, WBGene00023607
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region