WormMine: Gene WBGene00023615

• WormBase Gene ID: WBGene00023615
• Gene Name: CBG00143
• Sequence Name: CBG00143
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable 3-oxo-5-alpha-steroid 4-dehydrogenase activity. Predicted to be involved in steroid metabolic process. Predicted to be located in membrane. Is an ortholog of C. elegans F42F12.3. In C. elegans, F42F12.3 is involved in innate immune response.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG00143.1	CBG00143.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG00143	CBG00143		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1060536
• Remark: CBG00143, GCAATCATGGCCTGGAATCTTCCAGCTCTCGCCTTCGCCATTTTCACCGCTTCCAACATC, WBGene00023615
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region