WormMine: Gene WBGene00023665

• WormBase Gene ID: WBGene00023665
• Gene Name: Cbr-twk-18
• Sequence Name: CBG00233
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable potassium channel activity. Predicted to be involved in potassium ion transmembrane transport. Predicted to be located in membrane. Is an ortholog of C. elegans twk-18. In C. elegans, twk-18 is involved in locomotion; muscle contraction; and potassium ion transport.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG00233.1	CBG00233.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG00233	CBG00233		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly decreased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_downregulated

1 Expression Patterns

• Primary Identifier: Expr1054200
• Remark: Cbr-twk-18, AAAGACAACATCGACCAAGAATATGCTCGTGCTCTTAACGAGGCCCGTGAAGATGGAGAA, WBGene00023665
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region