WormMine: Gene WBGene00023715

• WormBase Gene ID: WBGene00023715
• Gene Name: Cbr-rlbp-1
• Sequence Name: CBG00305
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable GTPase activator activity and small GTPase binding activity. Predicted to be involved in small GTPase-mediated signal transduction. Is an ortholog of C. elegans rlbp-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG00305.1	CBG00305.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG00305	CBG00305		[unknown]

0 RNAi Result

71 Allele

• WBVar00135535
• WBVar00135536
• WBVar00135537
• WBVar00135538
• WBVar00135539
• WBVar00135540
• WBVar00135541
• WBVar00135542
• WBVar00135543
• WBVar00135544
• WBVar00135545
• WBVar00135546
• WBVar00135547
• WBVar00135548
• WBVar00135549
• WBVar00135550
• WBVar00135551
• WBVar00141119
• WBVar00039329
• WBVar00039334
• WBVar00039339
• WBVar00039314
• WBVar00039319
• WBVar00039324
• WBVar00061178
• WBVar00061183
• WBVar00061188
• WBVar00061063
• WBVar00061193
• WBVar00061068

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1056563
• Remark: Cbr-rlbp-1, AAATGGGTCTTCAAGCACTGGGATTATTGCTCCAGACGGTTCTGGAAATGTCCAGGAAAA, WBGene00023715
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region