WormMine: Gene WBGene00023749

• WormBase Gene ID: WBGene00023749
• Gene Name: Cbr-gcy-25
• Sequence Name: CBG00346
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity and protein kinase activity. Predicted to be involved in cyclic nucleotide biosynthetic process and intracellular signal transduction. Is an ortholog of C. elegans gcy-25.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG00346.1	CBG00346.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG00346	CBG00346		[unknown]

0 RNAi Result

18 Allele

• WBVar00061498
• WBVar00061468
• WBVar00061533
• WBVar00061503
• WBVar00061473
• WBVar00061538
• WBVar00061508
• WBVar00061478
• WBVar00061543
• WBVar00061513
• WBVar00061483
• WBVar00061518
• WBVar00061488
• WBVar00061458
• WBVar00061523
• WBVar00061493
• WBVar00061463
• WBVar00061528

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1055356
• Remark: Cbr-gcy-25, TGATCGATGAGTATAGTGCAAATTTGGAACATATTGTAGCTGAAAGAACAAGAGAACTGG, WBGene00023749
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region