WormMine: Gene WBGene00023876

• WormBase Gene ID: WBGene00023876
• Gene Name: Cbr-ssl-1
• Sequence Name: CBG00497
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity and ATP-dependent chromatin remodeler activity. Is an ortholog of C. elegans ssl-1. In C. elegans, ssl-1 is involved in negative regulation of cell fate specification.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG00497.1	CBG00497.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG00497	CBG00497		[unknown]

0 RNAi Result

21 Allele

• WBVar00141355
• WBVar00141351
• WBVar00141352
• WBVar00141353
• WBVar00141354
• WBVar00141337
• WBVar00141338
• WBVar00141339
• WBVar00141335
• WBVar00141336
• WBVar00141348
• WBVar00141349
• WBVar00141344
• WBVar00141345
• WBVar00141346
• WBVar00141347
• WBVar00141340
• WBVar00141341
• WBVar00141342
• WBVar00141343
• WBVar00141350

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1058631
• Remark: CBG00498, GCAAGGACCCAACGGCGGCCCTCAACAGCAGCGAATCAACGTGATGGTGCAACCGCAGAA, WBGene00023877
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region