WormMine: Gene WBGene00023888

• WormBase Gene ID: WBGene00023888
• Gene Name: Cbr-etc-1
• Sequence Name: CBG00511
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ubiquitin-protein transferase activity. Is an ortholog of C. elegans etc-1. In C. elegans, etc-1 is involved in positive regulation of metaphase/anaphase transition of meiotic cell cycle; regulation of metaphase/anaphase transition of meiosis II; and ubiquitin-dependent protein catabolic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG00511a.1	CBG00511a.1		[unknown]
Transcript:CBG00511b.1	CBG00511b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG00511a	CBG00511a		[unknown]
CDS:CBG00511b	CBG00511b		[unknown]

0 RNAi Result

1 Allele

• WBVar00141379

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1065962
• Remark: CBG00511, GTGAAGTCGTCAACATCGAATGGATGAGCATGTTCGCTCCACACGAACTACAAATTCTTA, WBGene00023888
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region