WormMine: Gene WBGene00023921

• WormBase Gene ID: WBGene00023921
• Gene Name: CBG00545
• Sequence Name: CBG00545
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Dual specificity protein phosphatase domain; Protein-tyrosine phosphatase-like; and Dual specificity phosphatase, catalytic domain. Is an ortholog of C. elegans F28C6.8.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG00545.1	CBG00545.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG00545	CBG00545		[unknown]

0 RNAi Result

3 Allele

• WBVar00008309
• WBVar00008304
• WBVar00008299

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1052755
• Remark: CBG00545, GAACTGTCAACGAGTATCGCCGGTTTTTGGATTCTAATTCTTCGTCGACGTCTTCTAAAT, WBGene00023921
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region