WormMine: Gene WBGene00023941

• WormBase Gene ID: WBGene00023941
• Gene Name: Cbr-iff-2
• Sequence Name: CBG00567
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable RNA binding activity; ribosome binding activity; and translation elongation factor activity. Predicted to be involved in positive regulation of translational elongation and positive regulation of translational termination. Is an ortholog of C. elegans iff-2. In C. elegans, iff-2 is involved in gamete generation; nematode larval development; and sex differentiation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG00567.1	CBG00567.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG00567	CBG00567		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	C.briggsae proteins that showed significantly increased at L4 larva stage than in emrbyo.	Benjamin and Hochberg corrected p-value < 0.05.	WBPaper00051425:CB_L4_vs_embryo_upregulated

1 Expression Patterns

• Primary Identifier: Expr1067076
• Remark: Cbr-iff-2, GAAAGAAGCTTGAAGATATCTGCCCATCCACCCACAACATGGATGTTCCAGTCGTCAAGC, WBGene00023941
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region