WormMine: Gene WBGene00023962

• WormBase Gene ID: WBGene00023962
• Gene Name: Cbr-fli-1
• Sequence Name: CBG00589
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable actin filament binding activity. Is an ortholog of C. elegans fli-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG00589a.1	CBG00589a.1		[unknown]
Transcript:CBG00589c.1	CBG00589c.1		[unknown]
Transcript:CBG00589b.1	CBG00589b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG00589a	CBG00589a		[unknown]
CDS:CBG00589b	CBG00589b		[unknown]
CDS:CBG00589c	CBG00589c		[unknown]

0 RNAi Result

1 Allele

• WBVar00003309

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1065733
• Remark: Cbr-fli-1, TTCATGTTGGCAGTAAGAGGACATGAAAGTTGTCGATTCAGAAAGTGTTTCCATGCTTGG, WBGene00023962
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region