WormMine: Gene WBGene00024013

• WormBase Gene ID: WBGene00024013
• Gene Name: Cbr-skpo-1
• Sequence Name: CBG00649
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable heme binding activity and peroxidase activity. Predicted to be involved in response to oxidative stress. Is an ortholog of C. elegans skpo-1. In C. elegans, skpo-1 is involved in defense response to Gram-positive bacterium; determination of adult lifespan; and negative regulation of gene expression.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG00649.1	CBG00649.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG00649	CBG00649		[unknown]

0 RNAi Result

7 Allele

• WBVar00063533
• WBVar00063518
• WBVar00063538
• WBVar00063523
• WBVar00063508
• WBVar00063528
• WBVar00063513

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_upregulated

1 Expression Patterns

• Primary Identifier: Expr1068319
• Remark: CBG00649, TATTTTGAGAATCCAGGAGTATTCACATCTTCTCAATTGGCTGAACTGAAGAGGACCACA, WBGene00024013
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region