WormMine: Gene WBGene00024068

• WormBase Gene ID: WBGene00024068
• Gene Name: Cbr-mig-5
• Sequence Name: CBG00722
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in Wnt signaling pathway and intracellular signal transduction. Is an ortholog of C. elegans mig-5. In C. elegans, mig-5 is involved in several processes, including cell differentiation; inductive cell migration; and non-canonical Wnt signaling pathway.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG00722a.1	CBG00722a.1		[unknown]
Transcript:CBG00722b.1	CBG00722b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG00722b	CBG00722b		[unknown]
CDS:CBG00722a	CBG00722a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1064145
• Remark: Cbr-mig-5, CACACGATCAAACTTGGCTGAGAAGAAGAAGAGACTGCGAGAGTCCAATGACTAACGACT, WBGene00024068
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region