WormMine: Gene WBGene00024180

• WormBase Gene ID: WBGene00024180
• Gene Name: Cbr-gcy-4
• Sequence Name: CBG00851
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable protein kinase activity. Predicted to be involved in cyclic nucleotide biosynthetic process and intracellular signal transduction. Is an ortholog of C. elegans gcy-4. In C. elegans, gcy-4 is involved in chemosensory behavior; chemotaxis; and response to salt.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG00851a.1	CBG00851a.1		[unknown]
Transcript:CBG00851b.1	CBG00851b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG00851b	CBG00851b		[unknown]
CDS:CBG00851a	CBG00851a		[unknown]

0 RNAi Result

29 Allele

• WBVar00141469
• WBVar00141467
• WBVar00141468
• WBVar00141470
• WBVar00053754
• WBVar00053749
• WBVar00053744
• WBVar00053714
• WBVar00053719
• WBVar00053704
• WBVar00053709
• WBVar00053739
• WBVar00053734
• WBVar00053729
• WBVar00053724
• WBVar00053674
• WBVar00053679
• WBVar00053669
• WBVar00053699
• WBVar00053694
• WBVar00053684
• WBVar00053689
• WBVar00021634
• WBVar00021639
• WBVar00021644
• WBVar00021649
• WBVar00021654
• WBVar00064488
• WBVar00064493

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1064750
• Remark: Cbr-gcy-4, AAATTCCGAATTCCCCACTTGCCGCGAGAGAGGGTGGAGCTAAGAGTTGGAGTTAATAGT, WBGene00024180
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region