WormMine: Gene WBGene00024188

• WormBase Gene ID: WBGene00024188
• Gene Name: Cbr-pax-3
• Sequence Name: CBG00861
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable DNA binding activity. Predicted to be involved in regulation of DNA-templated transcription. Is an ortholog of C. elegans pax-3. In C. elegans, pax-3 is involved in epidermal cell fate specification; gonad morphogenesis; and hemidesmosome assembly.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG00861a.1	CBG00861a.1		[unknown]
Transcript:CBG00861b.1	CBG00861b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG00861b	CBG00861b		[unknown]
CDS:CBG00861a	CBG00861a		[unknown]

0 RNAi Result

26 Allele

• WBVar00064698
• WBVar00064638
• WBVar00064703
• WBVar00064643
• WBVar00064708
• WBVar00064648
• WBVar00064713
• WBVar00064653
• WBVar00064718
• WBVar00064593
• WBVar00064658
• WBVar00064598
• WBVar00064663
• WBVar00064603
• WBVar00064668
• WBVar00064608
• WBVar00064673
• WBVar00064613
• WBVar00064678
• WBVar00064618
• WBVar00064683
• WBVar00064623
• WBVar00064688
• WBVar00064628
• WBVar00064693
• WBVar00064633

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1050559
• Remark: Cbr-pax-3, GACAGGGCTATCGGAGGAAAAAATTATGACATGGTTCTCTAATAGAAGGGCACGGTGCCG, WBGene00024188
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region