WormMine: Gene WBGene00024195

• WormBase Gene ID: WBGene00024195
• Gene Name: Cbr-mel-11
• Sequence Name: CBG00870
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable protein kinase binding activity. Is an ortholog of C. elegans mel-11. In C. elegans, mel-11 is involved in embryo development and embryonic body morphogenesis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG00870a.1	CBG00870a.1		[unknown]
Transcript:CBG00870b.1	CBG00870b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG00870b	CBG00870b		[unknown]
CDS:CBG00870a	CBG00870a		[unknown]

0 RNAi Result

6 Allele

• WBVar00064893
• WBVar00064878
• WBVar00064898
• WBVar00064883
• WBVar00064903
• WBVar00064888

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1060808
• Remark: Cbr-mel-11, AATGGAAAATCAACGGTTGAAGGAGGAGAACGGAGCGCTGGTCAGGGTCATTTCGAAGAT, WBGene00024195
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region