WormMine: Gene WBGene00024201

• WormBase Gene ID: WBGene00024201
• Gene Name: Cbr-mtrr-1
• Sequence Name: CBG00882
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable FMN binding activity and oxidoreductase activity. Is an ortholog of C. elegans mtrr-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG00882.1	CBG00882.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG00882	CBG00882		[unknown]

0 RNAi Result

11 Allele

• WBVar00065018
• WBVar00065053
• WBVar00065038
• WBVar00065023
• WBVar00065008
• WBVar00065058
• WBVar00065043
• WBVar00065028
• WBVar00065013
• WBVar00065048
• WBVar00065033

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	C.briggsae proteins that showed significantly increased at L4 larva stage than in emrbyo.	Benjamin and Hochberg corrected p-value < 0.05.	WBPaper00051425:CB_L4_vs_embryo_upregulated

1 Expression Patterns

• Primary Identifier: Expr1058116
• Remark: Cbr-tag-165, CGGAAAACGCGAAAATTTTCATTTGTGGCGACGCGAAGGGCATGTCGAAAGACGTTTGGC, WBGene00024201
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region