WormMine: Gene WBGene00024204

• WormBase Gene ID: WBGene00024204
• Gene Name: Cbr-daf-19
• Sequence Name: CBG00885
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable DNA binding activity and DNA-binding transcription factor activity. Predicted to be involved in regulation of DNA-templated transcription. Is an ortholog of C. elegans daf-19. In C. elegans, daf-19 is involved in several processes, including defense response to Gram-negative bacterium; male mating behavior; and positive regulation of transcription by RNA polymerase II.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG00885a.1	CBG00885a.1		[unknown]
Transcript:CBG00885b.1	CBG00885b.1		[unknown]
Transcript:CBG00885c.1	CBG00885c.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG00885c	CBG00885c		[unknown]
CDS:CBG00885b	CBG00885b		[unknown]
CDS:CBG00885a	CBG00885a		[unknown]

0 RNAi Result

24 Allele

• WBVar00135653
• WBVar00135654
• WBVar00135655
• WBVar00135633
• WBVar00135634
• WBVar00135635
• WBVar00135636
• WBVar00135637
• WBVar00135638
• WBVar00135639
• WBVar00135640
• WBVar00135641
• WBVar00135642
• WBVar00135643
• WBVar00135644
• WBVar00135645
• WBVar00135646
• WBVar00135647
• WBVar00135648
• WBVar00135649
• WBVar00135650
• WBVar00135651
• WBVar00135652
• WBVar00015814

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1058115
• Remark: Cbr-daf-19, AATCACTGTCACCCGCCAAGACAAGGATTGGCCGCTGGCCAAAGAGGCCAAAGAGTACAT, WBGene00024204
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region